Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4179
Length(NT) : 1613
Best Gene Model Blast : Link to GSTUMT00011669001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_01530
Accession: ref|XP_001597336.1| Score: 461 E_value: 8e-44
KEGG Definition: hypothetical protein
Accession: mgr:MGG_13413 Score: 460 E_value: 5e-44
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1162 Score: 350 E_value: 1e-33
PFAM Definition: SPX, SPX domain. We have named this region the SPX domain after (SYG1, Pho81 and XPR1). This 180 residue length domain is found at the amino terminus of a variety of proteins. In the yeast protein SYG1, the N-terminus directly binds to the G- protein beta subunit and inhibits transduction of the mating pheromone signal. This finding suggests that all the members of this family are involved in G-protein associated signal transduction. The N-termini of several proteins involved in the regulation of phosphate transport, including the putative phosphate level sensors PHO81 from Saccharomyces cerevisiae and NUC-2 from Neurospora crassa, are also members of this family. NUC-2 contains several ankyrin repeats pfam00023. Several members of this family are annotated as XPR1 proteins: the xenotropic and polytropic retrovirus receptor confers susceptibility to infection with murine leukaemia viruses (MLV). The similarity between SYG1, phosphate regulators and XPR1 sequences has been previously noted, as has the additional similarity to several predicted proteins, of unknown function, from Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, Schizosaccharomyces pombe, and Saccharomyces cerevisiae. In addition, given the similarities between XPR1 and SYG1 and phosphate regulatory proteins, it has been proposed that XPR1 might be involved in G-protein associated signal transduction and may itself function as a phosphate sensor..
Pfam Number: pfam03105 Score: 122 E_value: 4e-07
Swissprot: Q8S403|PHO1_ARATH
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig4179
TTGGTGTAGGTGTCCGTGCGTTGGCGATGCCGGCACCGCGGTCAGCGGAT
TCCCATTCTTACAGCCATTCTGATCGTTATACCGATGATCTCCCCTCAGT
TCCGCCTGACCTCATGCTCCCGGACCCTATACAACCTCTTCAACCTCTCA
TTGAACTTGGCCCTGAGTCCAACATACCCAGCAAACCCAACCCCTCGGTT
CCGCCCTCACGACCAGAAAGTATCGGATTAGCTGAGGATCTCCCCCCTCT
TCCAGGTGCTTCATTCTCACGCGATCACACAGGAGGCCGTCGACTCTCTA
ATATTACTGCCCGTGCCTTTAGACCCCTGTCGTCAGGCTTTTTGCGACGC
TCCGCCATTGCCAGCCCACGGCCTTTCGTAAACCGCCTGTCCTCCTTTTT
TGCCGTGCCGTGGCAAACAACCGACACCTCTACTATTGATATCACCGAGG
CCCAGTTGGCAGCCTCTGCTGAATTCCAGAAGTGGCTACTCATGGAGTTG
AATAAGATTGAGAACTTTTACAAACGGAGGGAGTCAGAGGCCATCGTTAG
ATTTGATGAAATGAAGGAACAGTTGGCAATCCTAAGGTTAAGATGGCTAA
AGGCCCACCCTCGGACCCATGGCGATCCAGGCGGACTTGAATTTATTGAA
GAGCGCCTCGAAGATAATGTTGTGGATAAACGTATGGATAAACAGTCTTC
CGCTTGGAGCTCTACTGGTACCGAGAACTCGTCCAAACGCACCCTTGACC
CATCTGCCCATCGGAGAATTGGATGGAAAACTTCAATTGTGGCACTGACT
GGGCTTAAACCACCCCAGTCTTCAAGTCAGGAAGTGATGGGGCCGGCAAT
CTCTCACAGGATGGACTCACGGCGTGATTACGAGCGCCGAGAGCCGATTA
ACGATCCAACTCACCGGCTAGCAAAATCAAGGCTCAAACGCGCATTCATC
GAATATTATCGACGTCTTGAGCTCCTGAAATCCTACGTCTGTGTCAACAA
GGATGCCTTCTGCAAGATGACCAAAAAATTCGATAAGGCTTCCGGTCTAC
GGACATCACCCAGGTTCCTCAATGAACACATTAACAAGAGCTATTTTGCT
GGATCAGAGAACAAGCTTGATGATTTGATCAATGAGACCGAAATATTGTT
CGCTAGGTTTTTCATGAAATCAAATCGGAAAGAGGCAGCTATGAGGCTTC
GGACACGAGAGAACAAATCTGCTTATCACGCATCTTTTCTTCGAAGTGGC
TTCTACCTAGGGTCTTCGCTGGTCATCTGCGCATATGGCTTGTGGCAAGC
CATGCGCCAGCTTAACAGCAGTGCGCCAGATGTACGCCTGAAAACCGGCT
ATTTGTTACAGCTCTGGGGTGGCGTTTCCCTCCTCCTACTTCAAGTCTTC
TTGTTTGCAATCAATTTAAGGGTTTGGGCAAAACATAAGATTAATTACGC
TTTCATCTTTGAATTCGATGCCAAATATCAACTAAACCATCGTCAGTTCT
TAGAGATTCCTTCACTTTTCATTACAATTTTTGCGATATGTTTTTGGTTC
AGCGTTTACGACTTCTGGTCAGGTCAACTTGATATGATACATTTCCCCAT
TATATACATATCC

Sequences in the Contig:

SY0AAA60YM16FM1 SY0AAB58YK05FM1 SY0AAC26YO08FM1
SY0AAC34YD17FM1 SY0AAC9YJ05FM1