Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4178
Length(NT) : 1275
Best Gene Model Blast : Link to GSTUMT00005110001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: nitrogen permease regulator Npr2, putative
Accession: gb|EDP55797.1| Score: 607 E_value: 7e-61
KEGG Definition: nitrogen permease regulator NLRG/NPR2
Accession: aor:AO090003000884 Score: 607 E_value: 3e-61
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG3789 Score: 661 E_value: 1e-69
PFAM Definition: NPR2, Nitrogen permease regulator 2. This family of regulators are involved in post-translational control of nitrogen permease..
Pfam Number: pfam06218 Score: 606 E_value: 2e-63
Swissprot: Q9WUE4|TUSC4_MOUSE

Sequence:
>Contig4178
TCTAGGAAATTTGAAATAGGCCTGATGCCGCTCCGGAGACAGCCAACTGA
TATGCCTATGTTGACCAGAGCTTCGATAAGATCTTGGAACTTGCGAATGG
GAAAGGGAACCCCCCTTCTGCTGTCACTCTGGAACAGATGACCGAGTTTG
AGGTTGTACGAACCCACCCCGTCCTCAAGTAATAGCTCAACCGCCTCTCG
GAGTGATGCGTTGTGTTTGGACCCATTATTGTAGGACCCTTTCCAGCCCT
TTAACCACAGCACTTCGTCGTTTTCTCTAGGGGCCAGGTCGAGATAGGAG
TACCCTCGCATTGGGCTATTTAACTTGACAAAAGGTCGGAGATGAGAAGT
GTTCGGAAACCGAGCTATGAGCCAGGAGATGCGATGCGCAATCAATCGCT
CTCGGCCCCAGTATATCTCAATTATGTGGTTTGGCCTAGATTGCAGATTC
CCCATACTGGATAGAAAGGCCTGATACAAAGAGGGAGGCAGAATTGAAGT
AGTTCGAGAAACTGTCAGGGGACAACTTTGTACAAAAAAGTTGGGGGGAC
AACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGTC
ACCACCGCCGCCAACAATGATGGCAATCCCGCTCCCATAACACCACCACT
ACCCCCCACCTCTCCACCACCAGCCTCCCCCCCGCTCTTCGACTTTGAGA
CCGTCAGCGAGTACATCATCCCCAAGCAGGAACTCTGCGACCGCCTCGTG
ACCGTCTGCACGAACAAATACCGCATCCTGGGCTACCCGGTGTGCCTGGA
GGACCGGAAGTACGAGCGCAACGAATTCATCTTCAACTTTGCCATTGTCC
TCGACGAAGGCGTCGTTGAGTACAGCACTTACAAGAGCGTTATTAGGAAG
GTGGCCAAACTGTTCAAGGCGCTCGAGGAGCAGAGCGGCTTCCTCAGCAA
TGAGGTTACGGCCGTGGGCGTGTTTGCCTTGATTGAGCAGGTGTTGGAGG
ATTTGAACAATTATTCCGAGTGCATGATTCCTATTAATGAGAGTAATACA
ATCAATATCAAGCTTTTCCCAACGTATGCTCCACCGCCGCAGGTTAAGGC
TTTTCATGTGCCGGTTTGTACGGTGCAGTTGGAGCGTTTGATGGACGTTA
ATTGGGATCTTACGATGCAGAAGATCGTCCCCTTCATCGACGGTATAAAT
TCTGTCAGGAGGATATCGGAACTGGCAGACGCAGATTACAACCTCACGAG
GAAGTGTATCGAACATTTGCTGTAT

Sequences in the Contig:

SY0AAB14YM06FM1 SY0AAC26YO06FM1 SY0AAD63YM05FM1