Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4177
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00004848001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU00656
Accession: ref|XP_965796.1| Score: 408 E_value: 3e-38
KEGG Definition: hypothetical protein
Accession: ncr:NCU00656.1 Score: 408 E_value: 1e-38
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0906 Score: 305 E_value: 6e-29
PFAM Definition: PI3K_C2, Phosphoinositide 3-kinase C2. Phosphoinositide 3-kinase region postulated to contain a C2 domain. Outlier of pfam00168 family..
Pfam Number: pfam00792 Score: 203 E_value: 5e-17
Swissprot: Q5D891|PK3C3_PIG

Sequence:
>Contig4177
TTGGCTCTGTTCATCGGTATACTTTTCGCGCAGCATCGGATATCTAAAGC
TTTCTCTCTTCCTCTTTCACAAATTTTGCTTTGTTTTGGTGTGGGGGAGG
GAGAGCTTCTGATCGAGCTTAGCTTTTCAAAATTTTGCTCACACGAACGA
GCTGTGTATTAGATAAGGTTACGCTATTATTCCACTGCCAACTATGGAAC
CGTTTACTTTCGCGAGCTCGGGGTCGCTGGAGAGGAATGTTGAAGTGAGG
ATTGATTCGCTTGAAGGGCAGCGGTCCTCCCTAGCTTATACGACGCTTAT
GGCGGACCCCAGTTTGAAGCATGTTGGATCGAATACCACGCCCTATTCGG
ATATGTATGTCACTGCACAGCTGTTCGCTGATAGTAAACCGCTAGCGGTT
CCAGTGCAAACTTCTTATAAAGCATTTAAGAATCAGAGATTGTGGTCTGA
ATGGCTCACGGTGCCAGCGAAGTATTGCGATTTACCTCTATCGTCACAGC
TCGCGATTACATTATGGGATTTGGCTGGCCCTGGGAGGCCGGTGCCGTTT
GGAGGGACTACGGTGACTTTGTTTGAGAAGGATAAGTATGATACGTTCAG
TGTCAATACTTTGGGGCTTTGCCTTTGACTGATGCCGT

Sequences in the Contig:

SY0AAB35YL05FM1 SY0AAC26YO05FM1 SY0AAC48YJ23FM1