Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4176
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00001830001 E-value : 1e-124
Numbers of ESTs : 2

Blast Results:

Nr Definition: MOB1_NEUCR Probable maintenance of ploidy protein mob1
Accession: ref|XP_663892.1| Score: 351 E_value: 3e-52
KEGG Definition: maintenance of ploidy protein Mob1; K06685 maintenance of ploidy protein MOB1 (MPS1 binder 1)
Accession: ani:AN6288.2 Score: 351 E_value: 2e-52
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG1903 Score: 285 E_value: 2e-26
PFAM Definition: Mob1_phocein, Mob1/phocein family. Mob1 is an essential Saccharomyces cerevisiae protein, identified from a two-hybrid screen, that binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Mob1 contains no known structural motifs; however MOB1 is a member of a conserved gene family and shares sequence similarity with a nonessential yeast gene, MOB2. Mob1 is a phosphoprotein in vivo and a substrate for the Mps1p kinase in vitro. Conditional alleles of MOB1 cause a late nuclear division arrest at restrictive temperature. This family also includes phocein, a rat protein that by yeast two hybrid interacts with striatin..
Pfam Number: pfam03637 Score: 288 E_value: 7e-27
Swissprot: Q9P601|MOB1_NEUCR

Sequence:
>Contig4176
TTGGCACACAAGCATACCATCACCGCAACCCTCTCCACCCATCACTCCCC
GCTGCCACCACCACCACCACAACCCCGAATCGAGCATCGCTTAGCTTTCT
CCCATTCCTCCATCATTCCAGACCGTCTCAGTCCATCTGACCATTCCCCC
TCCACCAGCGTAATTCGCTAACTGCCCCAGCATCAAAACAAATAATAAAC
CCTCCAACCACCTACCTGCCCGCGGCTCTTTCTAGGGAGAGAGGGGAAAA
GAGAGCTATGACCTCCTTCATGAACTCAATAAACCAGAAGACGCGCGCCC
CGTTTAAGCCCAAGTCATCCTCTCGTGGCTCCTCGTCGTACCAACTCCGG
CAGTATGCAGAGCAGACGCTTGGCAGCGGGAGTTTGAGGAAGGTGGTCAA
GCTGCCGGAGGGTGAGGACTTGGATGAGTGGTTGGCAGTTAATGATCAAT
TTACTCTATGGTTCTATTACGGAGTTTTGCTCGCCCGTGACATGTCCGGA
GATGAAAGCTACCGATGAGTTCGAGTACCTCTGGCAGGATCAGAACAAGT
ATAAGCGTCCGACAAAGATGCCGGCTCCGGAGTATATCGAGCACTTGATG
GCTTGGGTGCAGAACAATATCAATAATGAGCAGATTTTTCCTTCGAGGAT
AGGCGTTCACTTTCCGA

Sequences in the Contig:

SY0AAC26YN19FM1 SY0AAC54YJ24FM1