Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4174
Length(NT) : 814
Best Gene Model Blast : Link to GSTUMT00003206001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN4365.2
Accession: ref|XP_661969.1| Score: 161 E_value: 3e-19
KEGG Definition: hypothetical protein
Accession: ani:AN4365.2 Score: 161 E_value: 2e-19
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1977 Score: 141 E_value: 9e-10
PFAM Definition: No Hit Found
Swissprot: P57633|MUTL_BUCAI
Gene Ontology:
GO:0006298 = Biological process: mismatch repair

Sequence:
>Contig4174
GGGTTAGCTAAATTACCAAAGTACCGGTACGGTACTACAATAGTAAGAAT
TTCCTCCGCTACATTGCATTACTATAGGTATCGCGTCGTCTTGCACCACT
GTTCCTGCAAGCCCATCTTCACCACCAAAGATGTCAACCACAGCCCCACC
CATCAGGCTCCTGCCCGAGTCTGTTAGCGCGCGAATACGCAGCACCTTAA
CAATAACGAATATATCCGACGTGATATCAGAGCTACTCCAGAACGCAATC
GACGCGGGAGCTCGCAATGTGGCAATTGCTGTGAATCTAGGCAGGAATAG
CTGTGTGCTCGAGGATGACGGTCATGGGGTAACTCCAGAGGGCATGCTCC
TTGTCGGACGGGAACATGGTAACTATCTGATCTTTCCCCGCCCACAATTC
TGTACCGCTCAAATCGTGGCTGATGTTTCCTCCGTCACTTTGTTGTCGGG
TAGCTACCTCTAAATACCCGCCCGCTGGAGACTTTGGTTTCCGGGGACAG
GCTTTGTCGGCTATTTGTAGGCACTCCCTAACTACGATTACCTCCCGAGC
GGACGCGAGCGGACGGACGGTTATGCGGAGGGTGTCGTACGGTCGCGAGT
TGTTTACCGGGGCAGCGCCGGAGCACCTGGAGCTCAGGAGGTCGGGTACG
GTGGTTAGGGTTGAGGGGTTGTGGGGGGACATGCCGGTACGGGTTAAAGT
TAGAGAGGGCGTGGATGTGGACAAGGAATGGGACGATACGAAGCGGGGGA
TCGTGATGGTGCTCCTGAGCCGCGGGGGCGTGGGTGTTGTTGTCAAGGAT
GAGAACGGGGAGGT

Sequences in the Contig:

SY0AAA25YE05FM1 SY0AAA38YA23FM1 SY0AAC26YM11FM1