Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4173
Length(NT) : 718
Best Gene Model Blast : Link to GSTUMT00007176001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_00463
Accession: ref|XP_001791148.1| Score: 358 E_value: 2e-32
KEGG Definition: hypothetical protein
Accession: ang:An07g08290 Score: 316 E_value: 7e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P23201|SPA2_YEAST
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck
GO:0005934 = Cellular component: cellular bud tip
GO:0000131 = Cellular component: incipient cellular bud site
GO:0043332 = Cellular component: mating projection tip
GO:0000133 = Cellular component: polarisome
GO:0005519 = Molecular function: cytoskeletal regulatory protein binding
GO:0007015 = Biological process: actin filament organization
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0007124 = Biological process: pseudohyphal growth
GO:0031384 = Biological process: regulation of initiation of mating projection growth
GO:0031385 = Biological process: regulation of termination of mating projection growth
GO:0007266 = Biological process: Rho protein signal transduction

Sequence:
>Contig4173
TTGGCCTGGGAGGAGGGGTTCCGTTGCAACAAAGCTTTCATCTTAAAAGG
ACAAACTTGAGAGGATCAGCGTTCGAGTCAAGATCCGGGGTCGAATCTCT
TACTTTTGTTAGGGCTTTTGTTTTCCTTTGTTCAACAAGGAGGGGCGAGA
ATATACTGGGACCAACCTCTTTTCACACGGCCATGAGCATCAACGGTAAT
ATCCCACGCTCGGCGCTTTCACCTGTTTCCGTAGCTGGCAGCGATTGGTC
TGGAATATCAGGGTACCAGAAGAGAACCTCTGATCAACAATACGGGGGAC
CACCACCTCGCAGCGGTTCACTTGCAAGCGGCGAGGGTATGGGGCCTCCG
GGACAGCGCCAGAATGTCTCACCACCATCATCGATAGCTCGATCTTCGGA
TGGAACTGGCCTATACGCTCAAAGTGATGCCTCGTCCCTCAAGGATATTA
TTCACGACGAGGAAGTCGCCGCTCACCATTCCGCCTTGAGGAAACTTTTA
CAACCATATCTATCACAGTCCGGCGATTCCCGACCTAATAAGGCCCGCGA
CAAGCTTCTTCGGCTAAGCGTGGTCCAATTCCGGGAACTTAGTACCGATG
TTTACGATGAGCTTCAACGACGGGAAGGGGTGGACGCGAGTTCTGGTCCT
AACGACAAATATCCGCCCTACTTGCTACCAAAAGAAAAGTTCCATCCGAA
GAGAAACCAGGCTCGGCA

Sequences in the Contig:

SY0AAA35YL24FM1 SY0AAC26YM07FM1