Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4172
Length(NT) : 2378
Best Gene Model Blast : Link to GSTUMT00004021001 E-value : 0.0
Numbers of ESTs : 66

Blast Results:

Nr Definition: NADP-specific glutamate dehydrogenase (NADP-GDH) (NADP-dependent glutamate dehydrogenase) gb|AAG28788.1|AF309087_1 NADP glutamate dehydrogenase
Accession: sp|Q9HFR6|DHE4_TUBBO Score: 2123 E_value: 0.0
KEGG Definition: glutamate/leucine/phenylalanine/valine dehydrogenases [EC:1.4.1.4]; K00262 glutamate dehydrogenase (NADP+)
Accession: aor:AO090023000923 Score: 1696 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2250 Score: 1295 E_value: 1e-143
PFAM Definition: ELFV_dehydrog, Glutamate/Leucine/Phenylalanine/Valine dehydrogenase..
Pfam Number: pfam00208 Score: 679 E_value: 1e-71
Swissprot: Q9HFR6|DHE4_TUBBO
Gene Ontology:
GO:0004354 = Molecular function: glutamate dehydrogenase (NADP+) activity

Sequence:
>Contig4172
TTGGAGCTCCTCCACCACCACCAGCTCCACCATCACCACCACACCCTGAG
AAATGTTTTGCATTCAGGTTATCGGAGCGTTTTTTCTTTTCTTTCCTCTG
AGAAAGAACGCTCCCCGCTCTATCGCAAATCAAAAAAACCTGCATTCGTA
CCCCGGTAGAGACCGCTAACTCTTGCGTACCCGTGACCTTTCTCTCTTCT
CACTTGTTTGATGTTTTATTTGCACACAGCATCCGCAAACAATGTGCTGA
GACCATGTCGGCATCTTCAGCGTTATGTATGTCACGCTATTGGAATGCCA
GCGCTCTCTTTCTACGAGTAGACTACCGGTAGGATCGGTCCGGCAGGGTT
TGCGGTTGAGTTGCTGTCGAGCATTACGCCAAAAGAAATCCCTCTTTGCC
CTCTTTGCCCTCTTTGGAATCGCACGATATGATAATTATGATAGTTGTTT
TTTCTCCCCCAGTCCTAACCTACGCCCCCCATCCCCCAAAGTACCGCGTT
GCGGAGGGCATACCCTGCTTTCTCCCGCTCGTCTTTTGGCCTTCAGGGTT
GTGGGGAGTTGTTCTTTCTGCCTTTAAAGGGAGGCCCTTCCCCCCCCCCC
CTCTGCGAAGAGCAGCCAGACGTGTCGCCTCTAGGTGAAGACTCTCGAGA
AAGCAAACCCGTCGAGACTTGCGAATCCTTTATCTACCCCTTCACTTCCG
CCCAACCCTACAAACCACTCCCTCCACATACCCCACTTCACAGAAAAAAC
AAACAAAAGCCTTCCAAACTTCACAACCTCAGATCAGTTAAACTTCAACA
TGTCCAACCTTGCCCCTGAGCCAGAATTTCAGCAAGCTTATAATGAGCTC
GTTCACTCTCTTGAGGGATCCAAGCTCTTTCTGACCTCTCCGGATCTCAA
GGCTGCTTTGCCTGTCGTCTCCGTCCCCGAGCGTGTTATCCAGTTCCGTG
TCACTTGGGAGGATGACCAAGGCAATTTCCAAGTCAACCGTGGGTATAGG
GTTCAATTCAACTCTGCTCTCGGTCCCTACAAGGGTGGTTTGAGGTTCCA
CCCCTCCGTCAATCTATCCATCCTCAAATTCTTGGGTTTTGAGCAAATCT
TCAAGAATGCGTTGACTGGACTCAACATGGGTGGTGGTAAGGGAGGGTCC
GACTTCGATCCCAAGGGAAAGTCTGACAACGAGATCCGCCGCTTCTGCTA
CGCTTTTATGCGTGAGCTCTCCAAGCACATTGGTCAATTCACTGATGTTC
CGGCTGGTGATATCGGTGTTGGCGGTCGCGAGGTCGGATACCTCTTTGGT
GCCTACAAGTCCTACAGGAACCAGTTTGAGGGTGTCTTGACTGGGAAGGG
AATCACTTGGGGTGGTTCTTTGATCCGCCCAGAGGCTACTGGTTATGGTC
TTGTCTACTATGTTGCTCATATGATTTCTTATAGCTCCGGTGGAAAGGAA
ACCTTCGCTGGAAAGCGTGTTGCTATTTCTGGTTCTGGAAACGTTGCCCA
ATACGCTGCCCTTAAGGTCCTCGAGCTTGGAGGAAGGGTCATCTCACTTT
CTGACTCCAAGGGTGCTTTGGTTGCCATTGGGGAGGAGGGTTTCAACGAG
ACCGACATTGAGCTCATTGCCCAGTTGAAGCTCGATAGAAAGTACCTCAC
CGAGCTCCACGCCGCTGAAGATTCCTTCCAGTCTCGCTTCAAGTACCTTC
CTGGCGAGAGACCCTGGTCTCACGTCGACAGGGTCGATGTCGCCCTTCCC
TCTGCGACCCAGAACGAAGTCTCCGAGCAGGAAGCTAGAGCCTTGATCGG
CAAGGGATGCAAGTTCTTGGCTGAGGGATCCAACATGGGATCTACCCAGG
AGGCTATCAACGTTTACGAGGATGATCGTAGATGTCGCAAGGCCGATGGT
CTTTGGTATGGCCCTGCTAAGGCTGCCAACTGTGGTGGTGTTGCTGTCTC
TGGTCTTGAGATGGCTCAGAACTCCCAACGTGTCTCCTGGACCTCTGAGC
AGGTCGACAGGGAGCTTGCTGGAATTATGGAGAGATGCTTCTGGAATTGC
TTGAACACCGCCAAGGAGTACTATGACATTGCCGATGGCGAGCTTCCTTC
TCTTGTTGCTGGTGCCAACATTGCTGGTTATGTCAAGGTTGTCAACGCTA
TGAAAGCACAGGGAGATTGGTGGTAAAACATTTCCTTAACCTCGTTCCTA
GTTTTTCCATAGTTTAGTTTAGTTGATTGGGTGTTGGATCTACACTTTTT
CCCCCTTCCTTTTTCTATTCTCCTTGTGTCATATTCAGCTGGTCAATTTT
CTGGGAGGTGTTGTGCGGTTTTTATGATTCGATGAATTCATTTTTCAGAG
AATAAATTACGCAGGGCTTTTTCTCTCG

Sequences in the Contig:

SY0AAA11YL10FM1 SY0AAA13YA24FM1 SY0AAA16YK24FM1
SY0AAA19YD08FM1 SY0AAA19YE05FM1 SY0AAA20YO11FM1
SY0AAA20YO11RM1 SY0AAA23YE12FM1 SY0AAA23YE12RM1
SY0AAA26YC12FM1 SY0AAA26YC12RM1 SY0AAA30YC22FM1
SY0AAA36YF07FM1 SY0AAA36YJ13FM1 SY0AAA37YI18FM1
SY0AAA37YL10FM1 SY0AAA39YI10FM1 SY0AAA41YK05FM1
SY0AAA42YI14FM1 SY0AAA43YA05FM1 SY0AAA44YO05FM1
SY0AAA44YP11FM1 SY0AAA48YD02FM1 SY0AAA50YI24FM1
SY0AAA50YM20FM1 SY0AAA55YB22FM1 SY0AAA56YK16FM1
SY0AAA59YG18FM1 SY0AAA62YK21FM1 SY0AAA62YN13FM1
SY0AAA63YE10FM1 SY0AAA63YE12FM1 SY0AAA7YE03FM1
SY0AAB14YB05FM1 SY0AAB14YF06FM1 SY0AAB17YC17FM1
SY0AAB17YF05FM1 SY0AAB17YF15FM1 SY0AAB24YE14FM1
SY0AAB25YC12FM1 SY0AAB29YB19FM1 SY0AAB29YP07FM1
SY0AAB2YB16FM1 SY0AAB2YJ13FM1 SY0AAB31YL01FM1
SY0AAB33YO02FM1 SY0AAB34YI18FM1 SY0AAB35YK18FM1
SY0AAB37YC24FM1 SY0AAB37YG03FM1 SY0AAB39YG14FM1
SY0AAB39YH10FM1 SY0AAB40YE22FM1 SY0AAB45YK23FM1
SY0AAB47YG05FM1 SY0AAB56YK01FM1 SY0AAB56YK11FM1
SY0AAB57YI20FM1 SY0AAB5YP03FM1 SY0AAB61YH05FM1
SY0AAB6YG10FM1 SY0AAB6YK10FM1 SY0AAB8YC24FM1
SY0AAC26YM01FM1 SY0AAC54YP10FM1 SY0AAC56YB23FM1