Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4171
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00008333001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: alpha-1,4-glucan lyase
Accession: emb|CAB52201.1| Score: 492 E_value: 3e-61
KEGG Definition: hypothetical protein
Accession: fgr:FG00143.1 Score: 291 E_value: 5e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4171
TTGGACTACATGTCCCAGCTTGTTCATGATCTGGATGCCTTCGCGGGCAT
CACTTGGGTCACCAAGCTTAAGGAGTCTGCAGATCGGAAGTATTGGATTT
TTTCGTCAACTGTCACGGAGGCTCTGGAAAGAGAGGGGAAAGAGCAATAT
TATAAAACTGGGGATGGGATGAAGCTTTTCCTTCACAAAGACCCCTTTCG
CATCCAGGTGATCGCATAATTACCCCTTTGGGCCCGGTTGCGTACTCACG
AGTGATGTGGTAGGCGGTCCGAGTGTTGACGCCGTTGCCCGACCTTTACC
CAATTCCGGAAGCACCTTCAACGGCCTCGCGTGCGACCGAGAAGATCGTT
TGGCAAACCTCCCCAGAGACCTTCCGCTGGAGCATTCACCCGGTGGTCTC
TGTTGTCAAGCAGGTTGTTTTGGATGTTATCAAAGCTGGGCATGGGGAGT
TTATTGGCTTTGGGGAGCAAGGAGGAACTAGTTTCATGAAAACTCCAACC
TTTATGAATTATTTTAATTTTGATAACATGCAATACCAGCAGGTATATAG
CAAGGGCCCTCTCGATGCCCGTGAGCCTTTATATCACTCCGATCCCTTCT
ATATGGACGTCAATTCAAACCCAGAGCACGCCAACGTTACAGCCAGCTTT
TTGGACAATTATTCCCAC

Sequences in the Contig:

SY0AAC16YO23FM1 SY0AAC26YL24FM1