Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4170
Length(NT) : 464
Best Gene Model Blast : Link to GSTUMT00010425001 E-value : 2e-67
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_12233
Accession: ref|XP_001587203.1| Score: 171 E_value: 4e-11
KEGG Definition: hypothetical protein
Accession: fgr:FG10840.1 Score: 163 E_value: 1e-10
KOG Definition:
Classification: [Amino acid transport and metabolism, Nucleotide transport and metabolism].
Kog Number: KOG1503 Score: 117 E_value: 2e-07
PFAM Definition: No Hit Found
Swissprot: O94413|KPR3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4170
CTCAAGTCAAAAATGGGAATTTATTCGAGGTCTACAAGTGATAGTTATGT
ACGAGTAGGTGTTAAAGCGACCATACATGCCATAACCACAAAGACACCGA
TTAAAGCCCCGAGCAATCATAATAGCCATTCCGAGTTCTTACAGAAACAG
CAAATGTGCGGGAGCTAAACCACAGCCTCATCCCCATTCATGCCAGGCTT
CCTCCCTGCCCCTTATCGCGCGGGCACCCCCTCAATTTCTACCAGCCACC
CATGAACTATCCCGCAAAAACGCCAACCCAAACAGAACCAGTGAAAATAA
ATGAAGTAAAAAAGGGGCAGTAGTCCAAGAGATCAATCAATCGTTCCTGA
AAAGAACGCTGATGCTTTCTCCGTGGTGGACTCGTCTAATTGCCTCTGCA
AAAACCTCACCAACGTCCAAGACTACCAACTTGTCACACAACCTCTTGTG
CTGGTCTTGAGGTA

Sequences in the Contig:

SY0AAC19YN15RM1 SY0AAC26YL18RM1