Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig417
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00009369001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_10231
Accession: ref|XP_001228158.1| Score: 164 E_value: 1e-15
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03162 Score: 119 E_value: 1e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig417
TTGGCAGCACAATTGAATAAGTATCGTGAGGTGGAAGATGGTGATGACTT
TTTTGCTGATACCGACGATCTCCCGACTCCGAGGCTCTCGCCCGCTAGAC
ATACTCTCCAGCAGCAAAAGTCTAACGCTTCCCTCTTGCTTACACCGCCT
TTGTCCGAATCAGCCACCAGAGGATCCCCCTCAGTAGACGACGATTTTGA
GAATGATTTCGAATTTCCTGCGGATGCTCCTCTACAACTGAATATTAAGA
CGGGTGAAAGTAATAGGCATCAGGTTCAGGTTTTGGATAGTGATTCTGAA
GATTGGGCAGAGGGTGGTAGTTTGGGAACGAGGTTTGGAGGAACAAGTAG
ACTTGGCTCGTCCATAATCTCGCCAAGCGTCTCGAGCGTTGCTGCCGAGA
GCGAAGACGAGGCACCATTGGATGGATTAGAGTTGCCCTCAGGAAATTTA
CCAGATCTTGCAGTAATTCTCGAACGGCAAAAACGTGCATCGTATCCTAT
GGATGCTAGCACCAGTTTCGAAACGAAAGAAGACCTAGCATCCAAGGAAG
AATTTTTTCGAAGGCATAGAAATCGGAGAAGGAGAGGAGGTATTTGACTC
AAGGAAATTAACGTTAAATCGGAACGTTAAACACAAGCCATCCACAAGGA
AAACAAGTCCCGTTAGGAGATCTGCAATGAGCCTGACTTTCACAACAA

Sequences in the Contig:

SY0AAA23YJ09FM1 SY0AAD9YC23FM1