Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4169
Length(NT) : 567
Best Gene Model Blast : Link to GSTUMT00010425001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: ribose-phosphate pyrophosphokinase
Accession: ref|XP_001263131.1| Score: 564 E_value: 2e-56
KEGG Definition: ribose-phosphate pyrophosphokinase [EC:2.7.6.1]; K00948 ribose-phosphate pyrophosphokinase
Accession: afm:AFUA_3G13380 Score: 564 E_value: 8e-57
KOG Definition:
Classification: [Nucleotide transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG1448 Score: 418 E_value: 4e-42
PFAM Definition: Pribosyltran, Phosphoribosyl transferase domain. This family includes a range of diverse phosphoribosyl transferase enzymes. This family includes: Adenine phosphoribosyltransferase EC:2.4.2.7. Hypoxanthine-guanine-xanthine phosphoribosyltransferase, Hypoxanthine phosphoribosyltransferase EC:2.4.2.8. Ribose-phosphate pyrophosphokinase i EC:2.7.6.1. Amidophosphoribosyltransferase EC:2.4.2.14. Orotate phosphoribosyltransferase EC:2.4.2.10. Uracil phosphoribosyltransferase EC:2.4.2.9. Xanthine-guanine phosphoribosyltransferase EC:2.4.2.22..
Pfam Number: pfam00156 Score: 106 E_value: 7e-06
Swissprot: P87171|KPR4_SCHPO

Sequence:
>Contig4169
TTGGGGCTGGTGTTAATGGCGTGGATAGGGGAAAGTCGCACCCACCCACG
CCCCTTCGAAGGACCAATACTGCGGAGTCTATCGGTAGCGACACTGCCAA
GGGGCGCTACAATCACCATCACCAGCACCATCAGAATCACCATGGCCACA
GCTCCTCTAGTGTATCTTCGTCGGTGAATGCCAATGAATGGGTCCCGCCA
AAGGGAACCGGTTATAAGCAATGGGTTGCCCAAGCTGGGACCTTGGTAGC
CGACCTCCTGACCTGTGCTGGAGCCGACCATATCATAACGATGGACCTCC
ATGACCCGCAGTACCAGGGCTTCTTCGACATTCCTGTTGACAATCTCTAC
GGAAGACCGCTGCTGCAGAGGTATATCAAGTACAATATCCCCGACTATCA
AAACGCAGTTATCGTGTCTCCCGATGCTGGCGGTGCAAAGCGTGCCACGG
CCATCGCGGACGCTCTAGGAATGGAATTTGCATTGATCCACAAGGAGCGC
CGTCCCACACGCATCACAGACCGCCAGAACGCTACAATGATGCTTGTCGG
TGATATCGTTGGCAAAG

Sequences in the Contig:

SY0AAB53YM24FM1 SY0AAC26YL18FM1