Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4168
Length(NT) : 415
Best Gene Model Blast : Link to GSTUMT00011820001 E-value : 4e-93
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4168
AAACAAGTTCTTTGTTGTTATAAACATAAAGAAAATTACCAAGCCTTCCT
AGACAATCCTTGTCTCCACAATAAATTCCTGTATAAGTCTTCTCAAGGCA
TACTAGTGTTGGCTTCCCCCTAATAAGGATGAATGTGATGTTAGTACCAC
AATGGATGAGTTAACCTCATCTGTAGTAGCTCATTTATCTTTTTCAACTG
CAAGGGAGGAGCCGATGCGGTGTTTTTAGTTTTTTTGTCTGTAATTTGAT
AACATCCGCTGGAAAATGCATTTCCCATTCGTCAAAAAAGTAAACAATAA
CCTTCCAAACTCAGCAGTACCGGCAACAACAAAGGCAGAAACGTGCCAAC
CAATTAAACGCTGCCCCGCCTTCATCGTTTTGAAATCCGTTTTAGTTTCC
ATGTCCTGTTCATAA

Sequences in the Contig:

SY0AAC21YC14RM1 SY0AAC26YL15RM1