Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4167
Length(NT) : 671
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 177 E_value: 5e-14
PFAM Definition: Plasmodium_HRP, Plasmodium histidine-rich protein (HRPII/III). This family consists of several histidine-rich protein II and III sequence from Plasmodium falciparum..
Pfam Number: pfam05403 Score: 187 E_value: 3e-15

Sequence:
>Contig4167
TTGGCGAGCGAAGAGTCTAGGTTCTGTGTGAAATATCTTTCAATCGTCTA
CCACTGCGCCATACAGATACTGCTAGCGCCAACATATTATCCTCATTATT
ATCTTTATTCTTAACCAAGATGCCTTGTAACGATTGTGAGGAGAGAAAAG
TTTGTTCAATACACTCCTACGCTCCGCAGCTTCCCTTTTCTGATTTCTGA
CTTGATAATTACATTCAACCACAAGCGGAAATTCATGAATCACTACGGTG
CGGCCATGGCAACACGCTTAAAAGACCTCGGAGTGACGTTAGCCTACACT
CTCAACGAACGTCTGGGCCAGCCCCCCACGAGCATTATTACCGAAAACTT
TCCTACCGACACACGCACCACCCTCAACACCCCCGGCACCCGCAGCACCC
CTACCATGCATGACACCTCCACCACCTCCACCACCCTCAACACTCTCCGC
ATCCGCAGCACCCCTACGACGCTTAACACCCTCACCGCCCTCACCGCCCT
CACCGCCCTCACCGCCCTCACCGCCCTCACCGTTCTCACCGTTCTCACCG
TTCTCACCGTTCTCACCGTTCTCACCGTTCTCACCGTTCTCACCGTTCTC
ACCACTCTCACTACCCCCAAAGCTCCCGACACTCCTAAACCCCACCGTAT
ATGCTGCCTCGGGCGAGATGC

Sequences in the Contig:

SY0AAC26YL15FM1 SY0AAC8YI15FM1