Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4165
Length(NT) : 1989
Best Gene Model Blast : Link to GSTUMT00004696001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: hypothetical protein ATEG_09878
Accession: ref|XP_001218500.1| Score: 1307 E_value: 1e-142
KEGG Definition: hypothetical protein
Accession: ang:An12g04670 Score: 1289 E_value: 1e-140
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2767 Score: 1045 E_value: 1e-114
PFAM Definition: eIF-5_eIF-2B, Domain found in IF2B/IF5. This family includes the N terminus of eIF-5, and the C terminus of eIF-2 beta. This region corresponds to the whole of the archaebacterial eIF-2 beta homologue. The region contains a putative zinc binding C4 finger..
Pfam Number: pfam01873 Score: 340 E_value: 2e-32
Swissprot: Q09689|IF5_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4165
TTGGACTGACCGTTTCTCTTTGCTCCACCCCCAGCTTTTGCCCTAAAAAA
TCCGAAGAAAAAAGTTTGCCCCGCGTTTCCACCCTCTACACCCTCAAACA
GGTGTTCATCAACTCTGTTCACTTACCCCCTTCCTTTGCCTTCTCGAGAG
CATTTTTATTTTCACGAACAACCGGAGATTAATAACAAAGCCGTCGTTGT
TCATGAATCTTTCCCCCACAAAAAATTCACCATCGATTCGCTCTCGGCTT
ATACGGCCTTTGAAAAAGACCAGACGGGCTTCTAACATACGCTCCATCAC
TTAAAAATCTGTTCTCCAGGCAACCTCAAAATCAAGGAGAAATTTTTTTC
CATTTGTTTTTTGTCGCCAAACAAAAGGGAATCCTCTCCACGACTAGCCT
ATCAGATCCGGTCCAGTTCATGCTGTTTTTTCTCGCCGCTCTTGCTTTAG
AATCATCAACCACCACGCAAACTTCGTCCAGTCAATAAGCTCCGATAAAC
CGCAATCATGGCTACCATCAATGTCCGTCGCGATGTTACTGATCCCTTCT
ACCGTTATAAGATGGAACGTCTTCAGTCCAAGATTGAAGGGAAGGGCAAT
GGTATCAAATCGGTCATTGTCAACCTTAGTAGTGTTGCTCATTCCCTGAG
TCGTGATCCTGCATATGTTGTCAAATTCTTCGGATTCGAGCTGGGTGCCC
AAGTCACTGCCAACCCTACTGACGATCGATATATCATCAATGGTGCCCAT
GACGCAGGCAAACTTCAGGGTTATCTTGATACCTTTATTTCTAAGTTTGT
GCTTTGCAAGAAGTGCAAGAATCCTGAGACCGATCTGATTGTTCAGAAGG
ATGGGACTATTCTTCGCGATTGCAAAGCCTGTGGTCAACGCACCGATGTT
GATGCTCGTCACAAACTTTCCTCTTTCATCACCAAGAACCCACCAAAGAG
GGAAAAGAAGGCCAGAGTCTCTAAAAAGAGTGGCAAGAAGAACGGCGATG
CCGAGAATGGCAACTCCCCTAAGGACAGTGGCTCTGAAGATATGAATGGA
GAGGCCGACGGCGGTTCTGATGACGAACTCACCCGCCGTATTCAAGCTGA
AGCCAAAGAGCTTCCTACAAATGGTGATGGCGTCGAGGCTAAGGATGACG
ATTGGGCAGTTGACATGTCAGAGGAAGCCATCAAGGCCCGTGCCCAGAGC
CTTCCCGATGATTTGAAGCGCTCTTTGGTCATCGAGGGCGACGACGAAGC
TGCCGGTGGTGACAATCCCTTCGATCAACTCGGATCTTGGATTGTGGCAC
AAAAAGCTGAGAACAATGGCGAAGTGGACGACGTGGAGATTTATAAGAAG
GCCCAAGCACTTGGCATTGAGTTGAACCATCGTACTCTTCAAGTACTTGC
TCAAACTCTCTTCGACGAGAATATCATCAAGAAGAACCAGGTCAAGGTTC
ACGCTGGTCTTCTCAAGAAGATGATAACTTCCGAACGCCATGAAAAAGCG
TTCTTGGGAGGAACAGAGCGTTTCGTGGGCAACGACCATCCAGAGCTTAT
TTCAGCTATCCCTACCCTTCTTATGGCATACTACGAAAACGATCTTGCCT
CGGAGGATACTATCACCAAATGGGGTAGCAGGGCCAGCCAGAAGTACGTC
GATGTTCAGACGAGCAAGAAGGTTCGCAAGGCAGCAGCGCCATTCCTCAC
TTGGCTTCAAGAGGCAGATGAAGATGGTAGTGACGATGATGAGGACGATG
ATGAGTAGGAGTGCGGCTTACGAGTCGCATAAGTATCGGCTTATGTTGCT
GCCTGGGGCTAACGCCAAGTTTGCATGTTATGATTGTTTCAACTTTAGTT
ATTTTTCCTGTTTTCTTTCCTGCCAACGGCATATCAATGCCAGTGTTACT
TTACGTGTTTTGAAATTCAGGGTTATGTAACGAAAGCAAAATTGCAAGTG
GAAATTTTACGACCGCTAAATGGTATAGCTCTTGGACAC

Sequences in the Contig:

SY0AAA22YF04FM1 SY0AAA22YF04RM1 SY0AAA22YM02FM1
SY0AAA30YB12FM1 SY0AAA31YH05FM1 SY0AAA31YH05RM1
SY0AAA31YK15FM1 SY0AAA33YG20FM1 SY0AAA35YN03FM1
SY0AAA39YJ12FM1 SY0AAA41YB17FM1 SY0AAA41YG21FM1
SY0AAA53YA02FM1 SY0AAA55YD18FM1 SY0AAA61YD14FM1
SY0AAB13YI10FM1 SY0AAB16YO22FM1 SY0AAB27YD14FM1
SY0AAB27YG12FM1 SY0AAB37YL12FM1 SY0AAB47YK17FM1
SY0AAB47YO22FM1 SY0AAB57YL16FM1 SY0AAC24YG04FM1
SY0AAC26YL05FM1 SY0AAC26YL05RM1 SY0AAC27YO14FM1
SY0AAC27YO14RM1 SY0AAC29YO22FM1 SY0AAC30YC13FM1
SY0AAC3YA05FM1 SY0AAC3YH20FM1 SY0AAC60YE06FM1
SY0AAC60YI08FM1 SY0AAD15YA16FM1 SY0AAD43YE18FM1