Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4164
Length(NT) : 801
Best Gene Model Blast : Link to GSTUMT00007138001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: Two-component system protein B precursor (Protein NHK1) (SLN1 homolog) dbj|BAB07814.1| NHK1
Accession: sp|Q9P4U6|TCSB_EMENI Score: 241 E_value: 9e-19
KEGG Definition: hypothetical protein
Accession: ani:AN1800.2 Score: 241 E_value: 5e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9P4U6|TCSB_EMENI
Gene Ontology:
GO:0005887 = Cellular component: integral to plasma membrane
GO:0000156 = Molecular function: two-component response regulator activity
GO:0000155 = Molecular function: two-component sensor activity
GO:0000161 = Biological process: MAPKKK cascade during osmolarity sensing

Sequence:
>Contig4164
TTGGCACCTCCTGTGCTTTTCTTTTCACTGTTTTTTCTTCCCAACTCATT
CAATCTTTTTTTCCCCGATTCTTTTCCATCTCACTTTGTCCGCCCTTCTT
CGACTCACTCTCCGAACCTGCTGATGGTTGAGACGGACAAGTTCTTTTCC
TCCCAAGTCTGAACTGCAGATCCGCTGCGAGGAGGAGTATCGGGCCCTTC
GGATCCTTCGCCTAGCTTTCGAAAGCGACATAGGCGCGGCAAGTGGCCAG
CAAACATGAGGATTCGCATTCGTGAACAGCTCAGTTTATTGGTCGCTCTA
ACAGCGCTGATAGCGGTTGGTGTCTTGGCCGTTGTAACATGGGTTCACAA
TTACCGACTAGTCCGTGAAGTTCGGTCATCGAGATTCTCGCTCACAGCCT
CGTTAAAATCTATACAGGTCACCCAGTCAATTGCCCTGCTACACAACACC
GTATATGCCATCAGCACTAGGGCCATCTTGCAGAGTTCTTTACGGAGGTA
CCAGAGGGGGAACAATACTGCGGATAATTGGCTACGGGCCATCGATGACT
TGAAAAACTCGGCTAGTGCTAGTATAGGAGGCTTCCCGTATGTCCTGCAG
GTGGTGGTCTACGATGAGAACCTTAGCAGCGGCATGGTTGGGGTGCCCGA
TGGAGCGGTGATCGACGGAATGCAACTTAGTGCTACGAACCCAAACTTTA
CCGGCAGACTACCGAATGGGACGGAGATAAAGGTTGGGAGCGGGCTGGGT
GGCAGAATGGGTCTGTTGAATGTTACGGGGGATAATGCTAATGGGGTTAT
G

Sequences in the Contig:

SY0AAC26YK18FM1 SY0AAC28YI23FM1 SY0AAC9YD08FM1