Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4162
Length(NT) : 938
Best Gene Model Blast : Link to GSTUMT00000447001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_13001
Accession: ref|XP_001803215.1| Score: 1060 E_value: 1e-113
KEGG Definition: cAMP-dependent protein kinase catalytic subunit (PKA) [EC:2.7.11.11]; K04345 protein kinase A
Accession: aor:AO090026000426 Score: 1024 E_value: 1e-109
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0616 Score: 992 E_value: 1e-108
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 591 E_value: 8e-62
Swissprot: P06245|KAPB_YEAST
Gene Ontology:
GO:0005952 = Cellular component: cAMP-dependent protein kinase complex
GO:0005634 = Cellular component: nucleus
GO:0004691 = Molecular function: cAMP-dependent protein kinase activity
GO:0005515 = Molecular function: protein binding
GO:0001403 = Biological process: invasive growth in response to glucose limitation
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0007265 = Biological process: Ras protein signal transduction

Sequence:
>Contig4162
TTGGCCCGAACATCAACAACAACAACGGCAGTACCAAAGTTCTCCTCACC
AGCCCCAGAGCCAACCTCACCAGAGCAATATTAACAGTATCATCAATCCC
CCCCAGTCTAGTGATTACTCGAGGCCGTATGATGGCAATAATACCCAAAC
AGGCGCTGCGCACTCAAACATGGCGCAATCACAAGAGACGGGAAATAATT
CCACTGGAAATTCTTCGCAAGAGAAGCCGTCTGAAGAGCAGCAGCGGCAG
CAACAAGCTGCTGTTAGGACGACTAAAGGAAAGTATTCCTTGAGCGATTT
CACTATTTCGCGGACCCTAGGTACTGGGAGTTTTGGTCGTGTACACCTTG
TCCAGTCACGGCACAACCTCCGCTTTTATGCTGTCAAGGTCCTCAAAAAG
GCACAGGTTGTAAAGATGAAACAGGTAGAGCATACCAACGACGAGCGGCG
CATGTTACAGAAAGTTAAGCACCCCTTCTTGATAACGTTGTGGGGAACTT
TCCAGGATGGCAAGAATCTTTATATGGTGATGGATTTCATCGAAGGAGGG
GAACTCTTTAGTCTGCTACGGAAGTCGCAGCGATTTCCGAACCCCGTTGC
TAAATTCTATGCTGCGGAGGTTGCTCTTGCCCTCGATTACCTGCACTCTC
ACCACATAATCTACCGAGATCTCAAACCGGAAAATCTGCTCCTAGACCGG
CACGGCCATCTGAAGATTACGGATTTCGGTTTTGCCAAGGAGGTTCCAGA
CATAACCTGGACGCTCTGCGGCACTCCGGATTATCTAGCGCCGGAGGTAG
TTGCTTCGAAAGGATACAATAAATCTGTGGACTGGTGGTCCCTCGGTATC
CTTATCTTCGAAATGCTCTGCGGTTATACCCCATTCTGGGACGGAGGCAG
CCCTATGAAGATCTACGAAAACATCCTCAAAGGCCGAG

Sequences in the Contig:

SY0AAC26YJ08FM1 SY0AAD62YA05FM1 SY0AAD7YF02FM1