Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4161
Length(NT) : 609
Best Gene Model Blast : Link to GSTUMT00002873001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: Leucine Rich Repeat domain protein
Accession: ref|XP_001272030.1| Score: 397 E_value: 4e-37
KEGG Definition: Leucine Rich Repeat domain protein
Accession: afm:AFUA_4G11700 Score: 391 E_value: 1e-36
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4161
TTGGAAGAATATCACAACGACATCTGCCAGTCGTCCGATTGTACCATTGC
CCTTCCACCCACTTATCAACGGATCCATCGAGCCTTCTCTTCGCCAGCTC
TGGTTCCTGCTCGCACTATTGGGAGAATGGGGATTCACTACGAAGACTCG
ATGATTTTTGAGAAAGGACGGGCCCCGATAGAACTCCTACCCGTGGAGAT
TTTTGGTTGGTTTTTTGTGCTATCAAATCATCCCACAATTAGTGACCGAT
GTGCCTACCAACGGCTATAGCCCTAGGAACAAAGATTTGGCATCGTGCTT
ACTCGTCTCCCGGACCTTCCACATTGCCACTCTGTCGACCTTGTATTCTA
AGGTTGCCTTCCCTCATTCGTTCATCTTCGAAAAGTTCCTGGCGCAGATC
TCCAAGTATCCCGAGCTGGGCCATTTGGTGAAGAGGCTGGACTTCTCCCA
CTTTACTTCTGTGGGCTTTGGTAGAACTGAGCGTATGAATTCTGAGATTC
AGAAATTGACCGCTACAAAACTGCGCAATTGTCTCGATATTACTCCTAAT
TTGCGAGAGTTCCTTGCCTCTGAGGCTATGGGTAGAGATGTGGATGAGAG
AGTGCTAGA

Sequences in the Contig:

SY0AAC26YI21FM1 SY0AAC58YL18FM1