Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4160
Length(NT) : 1902
Best Gene Model Blast : Link to GSTUMT00008354001 E-value : 0.0
Numbers of ESTs : 37

Blast Results:

Nr Definition: hypothetical protein AN4546.2
Accession: ref|XP_662150.1| Score: 999 E_value: 1e-106
KEGG Definition: hypothetical protein
Accession: ani:AN4546.2 Score: 999 E_value: 1e-106
KOG Definition:
Classification: [RNA processing and modification, General function prediction only].
Kog Number: KOG2190 Score: 493 E_value: 4e-50
PFAM Definition: KH_1, KH domain. KH motifs can bind RNA in vitro. Autoantibodies to Nova, a KH domain protein, cause paraneoplastic opsoclonus ataxia..
Pfam Number: pfam00013 Score: 160 E_value: 2e-11
Swissprot: P57722|PCBP3_MOUSE

Sequence:
>Contig4160
TTGGCTCCATCACCTCTTCTTCTCTTCCTCTCCCCCTCTCCTCCTCTCCC
CCTCCTCTCTCTCCTACCTACCTCCTCCGCCTTTTCATCTATCTACCCCA
TTCCCTACCTACCCTCCCCCACCCCCGGCCTATCTAGTTTTCATCTCTCC
GCTATTTCTCCTATTTCTTCGATCACCCCACTACTTTTCGACCCGCATCG
CCCCACATCCAGCTATCCCTTGCCACATCCCCAACAACTTGCTCCCCCCA
ATCAAACCAAGGAAGCAAGCCCCACTCTAAAACCTTAAAGCAAACTTTAA
GATTCCTAACCTAACAACTCCCTTAATCCGTCATGTCCAACGAAGTCGCC
GATAACCACGACGGTTCTCCTGCTGGCGATGAATCACTTTTCGATAACTC
TTTTCAAAACCTGAATGTCAACGATGACCATCACGACGGGGACCACGAAG
GAGCTCGTACCGAGGAAGAGTATGCCCAATCGCCGCTCACCCTTCGCGCA
ATTGTTTCGTCTAAGGAAGCTGGTGTAATCATTGGCAAGGCTGGAAAAAA
TGTTGCCGATCTTAGAGAAGAGACTGGTGTGAAGGCTGGTGTGAGCAAAG
TCGTTACCGGGATCCCGGATAGAGTTCTCACTGTTACCGGGCCTTTGGAC
GGAGTAGCTAAGGCCTATGCGATGGTGTCTCAAACTTTGCTCGATAGCCC
TCCAAGTACGATCGGTGGTGGACCACCTCCAGGACCTGGAACTCTCCGCC
TGCTCATTTCCCACAACCAAATGGGGACCATCATCGGCCGCCAAGGATTG
AAGATCAAGCACATTCAGGATGTCTCAGGAACCCGTATGACTGCTGCTAA
GGAAATGCTCCCTCAATCGACTGAACGGGTGGTTGATGTTGCTGGAGATC
CTGAAGCTATTCGCACAGCCATCTGGGAAATTGGGAAATGCCTTGTTGAT
GACTGGCAGAGGGGTACTGGAACTGTTCTGTATAATCCTGCAGTCCGTAG
TCCCGGTGGCTCTAGCAGCGTTGGAATGGGTAATGGGATGGGCGGAAGTG
ATAGATACGGTGGTGAACGCGGCAACACTCGCTCTTACGCTCGCACTGGA
AACGGTGCCGACTTTTCTGATAGCTCGCCTCCCTATCGTCGCCATGATGG
TCCTTCCGGACGCCCTTCCGACCGTTCCCCATCCTCTTCCAATACCCAAC
CTATGCACACTGACGATGGAGAGGAAATTCAAACTCAGAATATCTCGATT
CCCGCTGACATGGTTGGATGCATTATCGGCCGCGGAGGAACCAAGATTCA
GGATATTCGCAGGAGCTCTGGTGCTAGGATCAGCATTGCCAAGACGCCCC
ACGGTGATACTGGAGAGAGAATGTTTACTATCATGGGGAGTGCAAGCAGC
AACGAAAAGGCACTTTACCTGCTTTACGAAAATCTTGAGGCTGAGAAATT
GAGGAGGAGTAATCAAGGAAGTCCTAACCACGAGATTGAATAGGCGTTTA
TCTCTTTATGGTTTGCTTCGCTTTCGAATGAAATGCAAAGTAGGAACTGT
CGAGTTAATACGAATTAACTTGATGTTTTTTTCTTTTTCTTTTCTGCTTG
TCTTTTTTCCCTCTCTTCTCCACTTCCTCTCCTTATTCTTCGCTCCACCA
CATTTTACTCCTACCTTTCCTTGCTTTGTTCTTTTCATTCTTACTAGTGG
AGGTGGGGAAATATTCATTTCACGAAAAGCTTCTGCTATTATTGTTTCTT
TTTTCCGAGAGAGCGAAGATGGGAAACCGGGTAATAGCTGGGAAAGTAGC
ATTTTCCTTGATGGGGTCCTGTATAGCTTTGGCTTAACAACCGGCGGGAG
TATGATGTAATGTGCTACTGGAAACGAAATCTCTAGTTTTATCATACACG
AG

Sequences in the Contig:

SY0AAA31YD05RM1 SY0AAA38YC19FM1 SY0AAB11YN11FM1
SY0AAB14YO19FM1 SY0AAB16YA23FM1 SY0AAB23YB12FM1
SY0AAB2YM06FM1 SY0AAB37YN18FM1 SY0AAB40YD11FM1
SY0AAB40YJ19FM1 SY0AAB55YA09FM1 SY0AAB8YD19FM1
SY0AAC13YO05FM1 SY0AAC16YJ21FM1 SY0AAC20YI15FM1
SY0AAC20YI15RM1 SY0AAC20YK04FM1 SY0AAC20YK04RM1
SY0AAC23YB24FM1 SY0AAC26YF01FM1 SY0AAC26YI13FM1
SY0AAC26YI13RM1 SY0AAC28YA16FM1 SY0AAC40YD03FM1
SY0AAC41YM22FM1 SY0AAC55YL05FM2 SY0AAC59YP11FM1
SY0AAC60YJ21FM1 SY0AAD13YE04FM1 SY0AAD13YO09FM1
SY0AAD20YB22FM1 SY0AAD22YN01FM1 SY0AAD24YK08FM1
SY0AAD28YO18FM1 SY0AAD38YB23FM1 SY0AAD3YO12FM1
SY0AAD9YM20FM1