Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4158
Length(NT) : 826
Best Gene Model Blast : Link to GSTUMT00011663001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CIMG_04926
Accession: ref|XP_001245485.1| Score: 529 E_value: 4e-52
KEGG Definition: regulator of gluconeogenesis Rmd5, putative
Accession: afm:AFUA_1G04490 Score: 498 E_value: 8e-49
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2817 Score: 326 E_value: 4e-31
PFAM Definition: No Hit Found
Swissprot: Q91YQ7|RMD5B_MOUSE

Sequence:
>Contig4158
TTGGTAAACTCTCACCTCGTCCCCATTTCCCCCGCCGCCGCCGAGCTGCA
GTCTACTCAAGGCGACTCTACTCATAACCTCCGTGCTCTTTGCCTCGTAT
ACCCACCCCTACAATCATGGAGGCTATTCAGAAGGAGTACGAGCGCCTGA
TCAAGAGGGCAAACCTCTCTAAGAGCATCAACGATGTCGAGCACTGTCTG
AGGTTATTGGAAAATGCCCGGGAAGCTATATTGAGAGATCCGACGACCTC
GAAAATGACTCTGGTGAAGCTGCAGCAAGCCATGAGCACAGGCCTGAGTA
AAGTCCAAGACGACCATAAGGAAATTTACACTGGACTCAACCGCTATGGG
AAAGCCCTTGACAAAACGTTCAAAGCGGTCTCTACCTATTCTACGAACGA
TTATGACGCTCTAACCTCCCAGGCGCCGCTTATAAAGCGAGCCATAGCTA
TGCACTTGATTCGCGAGGGCCAATTTTCTGTGGCAGATTTTTTCCTCACC
GAAGCCGGTCCAATCGATGTTCCGCCCGAACTTCAACAGGAGTTTCAAGA
GATGTACGAGATTCTAGACGCTATGCGTACCCGCCGTGACCTCTCTCTCG
CCATCGACTGGGCTCGTCAGAAATCGGCCCAACTCGAACAACGGGGTAGT
AATCTCGAGTTCGAACTTTGCAAATTACAGTTCATCTGGCTATTCATTGA
GCGACCGGAACGTGCTATGGCATACGCCAGGCGAGAGTTTTCGAGATTTC
AGGAAAAGCATTTGAAAGACATCCAGCAGCTTATGTGTGCCTTTTTGTTT
CTGCAATCTCCAGAAAAGTCGCCGTA

Sequences in the Contig:

SY0AAA37YM02FM1 SY0AAA44YM03FM1 SY0AAB61YM16FM1
SY0AAC26YI07FM1 SY0AAD13YL14FM1