Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4156
Length(NT) : 1405
Best Gene Model Blast : Link to GSTUMT00004327001 E-value : 0.0
Numbers of ESTs : 31

Blast Results:

Nr Definition: pyridoxamine phosphate oxidase family protein
Accession: ref|XP_001268241.1| Score: 548 E_value: 6e-54
KEGG Definition: hypothetical protein
Accession: ani:AN0555.2 Score: 529 E_value: 4e-52
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 175 E_value: 2e-13
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 156 E_value: 3e-11

Sequence:
>Contig4156
TTGGAGACATTACCAATCCCCAAACACCAAACCAAGACACCCCCCTCGAC
ATGCCAACGTTCTACCCTTCACTCACCGAAGACCTGATAACCTGGCTGCA
GACACAGCCCCTCTTCTTCACGGCTTCGGCGCCACGCTATGGCAAGCACG
TAAACCTCTCGCCGAAGGGCTACACCTCCCGCTCCTTTCGCGTGCTGAGC
CCGAATCAGGCCGCGTACCTTGACGCCACAGGCTCGGGCTCGGAGACTAT
CTCGCACATCTACGAGAACGGGCGAGTGACGGTGATGTTCACGTCCTTCT
CTGCGTCGCCGCGCATACTCCGTCTGTTCTGCACCGGGCGGGTGGTGGAG
GCCGAGAACGCGGAGTTCGATGATATTGTGCAGTCGTTCGGCCCACGGGG
GGAAGAAGAGGGGGGGGAGGGCAAGGGAGGGATGAAGGGGGCTAGGGCTG
TGGTCCTGTTGGATATTTTCAAGGTGCAGACGTCGTGTGGGTATGGGGTT
CCAATTGCCGAGGGGGCCCCTACGGGCGGGGAGGAAGGGGGAGGGGGAGT
GGAGGGGGAGGCACGGTTTGGGGAGAGGGAGACTATGGAGAGGTGGGCTG
AGAAGCAGATCGAGAAGGGGAACTTGGAGACGTATCGGGCAGAGTGGAAT
TCTTCCTCGTTGGATGGATTGCCCGGGCTCAGGAGCGCGCGGAGGGAGAA
GGGCGAAAGGGCTCTCTGGGTTGGGGATTTGCTGGCTAGGGCGAAGAGAG
TCGGACGTGAGTGGGAGGGGTTGCTGGTTGGGTTGGGAGTGGGTGTTGCG
GTCGGGTTCGGATTGCAGAGGTATTTGGTGGGGAGGTAAGTAGTGTGGCG
GTAGTACATACTTAGTAGGCATGTTCTGCCACTCGGGAGCTGGGAGGAGG
AGCTTTGTCGGAAATAGCCACACAAGCACGTACTAGTACATTAGCACACG
CCAGCTGAATGCACTAGCACTAAAAAATTTCTTCTTTTATATTTTCCTCT
TTACCTCCGATATCTTTTCACTTCATCGAGCAATCGACAAACTTCTCCTC
TCTTTAAACCCCCTTTTCTCCTGACTCGGTGCAACCTCCAGTTTGACCAT
TTCCCATTTCCCATTTCCAGCAAGGAAGGTGTGATGGAGAAGATCCAGTT
GAAATGCCAACCAGCTGTTAGGATTTACTCGATAATACTTTCATATATAG
CGCGTAGAGAAATCTACAGATGATTGTCGTTATTAGGGAATTCCTTCTAG
CGCATCTACGATACCTAGTGACACAGCTGACTAATAGCATGCCTACCCTC
CGCGTTACAGTCCCGCAATACCCCCTCTTCTACGCCCCAAGCCGACAATA
CGACCCCCAAACAGTTTCCCCAACGCCAGCACCACACTCCCAGCCGCGAA
TCGCT

Sequences in the Contig:

SY0AAA10YD17FM1 SY0AAA11YP23FM1 SY0AAA12YE21FM1
SY0AAB36YK09FM1 SY0AAB53YB14FM1 SY0AAC26YH21FM1
SY0AAC26YH21RM1 SY0AAC31YA19FM1 SY0AAC31YA19RM1
SY0AAC31YG10FM1 SY0AAC45YN18FM1 SY0AAC48YO07FM1
SY0AAC50YK13FM1 SY0AAC60YK11FM1 SY0AAC62YF15FM1
SY0AAC6YM05FM1 SY0AAC8YK01FM1 SY0AAD10YD12FM1
SY0AAD14YO17FM1 SY0AAD19YP06FM1 SY0AAD24YG12FM1
SY0AAD33YL01FM1 SY0AAD47YG01FM1 SY0AAD4YK07FM1
SY0AAD52YE12FM1 SY0AAD55YC24FM1 SY0AAD57YA21FM1
SY0AAD58YG12FM1 SY0AAD5YM01FM1 SY0AAD60YH05FM1
SY0AAD8YI16FM1