Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4155
Length(NT) : 1046
Best Gene Model Blast : Link to GSTUMT00008647001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_07344
Accession: ref|XP_001243448.1| Score: 483 E_value: 1e-46
KEGG Definition: G-patch domain protein, putative
Accession: afm:AFUA_3G07480 Score: 458 E_value: 5e-44
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0154 Score: 185 E_value: 9e-15
PFAM Definition: G-patch, G-patch domain. This domain is found in a number of RNA binding proteins, and is also found in proteins that contain RNA binding domains. This suggests that this domain may have an RNA binding function. This domain has seven highly conserved glycines..
Pfam Number: pfam01585 Score: 122 E_value: 2e-07
Swissprot: Q91YE7|RBM5_MOUSE

Sequence:
>Contig4155
TTGGACAAGGAAGTGATCGGAGCGGCTGTGCCCGTAACCAAGAAGTCCGT
TCCCGCCCATCTTCAATTCTGGCAGAATCGACACTCGGAACTTCACGGGA
TCCCTACACAGGTCCAAGAAAACAAAGGCGACAATGAGTCCACATCCGGA
AGCGAAAACAATGGATCCGGTTTATCTACGAAGAAACGTAAGGCCGAGGA
CCAACCTGATGAAACCCAGGCCCCCCAGTCCTTTGCGGACCTAAAAAAGC
TCGCTTGTCTCCTCTGTAGCCGACAGTTCAAAACTGCGGAGAAGATATAC
GAGCATGAAAGGGTCAGCAACCTTCACCTCCAAAACCTCAGGGATCCTAA
ACTACGGGAAACTGCCATGAGGAAATTGACAAAAGCCGGAATCGTGTCAA
CCCCCAACGACACAGCCGAGTACAGAGATCGCGCGAAGGAACGCAGACAG
GTATTCGGAAAGTCCACCGCCCCACAGTCCTCATCTAAGAAGAAAAAGAA
GGAGGGGCCTGAGCTTGAGCCCGAGCCTGCGTTGCCTAGCAGGGGAGCTG
CACTTCTAGGCAAGATGGGTTGGACCTCTGGACAGGGGTTGGGAGCGAGC
GGGGATGGAAGGACGGAGCATGTTATTGCCGAAATGTACACTCAGGGCGT
TGGATTGGGAATGAAGGGGGCCAAGGTTGGAGATGTTGAAGAGGTTGCAA
AGGGTGGCGGGGGTGGATATAATGACTTTGTCAAGCGGACCAAGGAAAAA
GCGAAGGAAAGGTATGAAGGGATGCAATAAGTGTAAAGGATAGGTCCACC
GTACCAGTACATTTTACTCTCTGTCGTACTGTACTGTACCACGATTCCCC
TTTTTTCTCTGACTAGCTGGCTCTCTTTTTGCGCTTGTACTGTACCCAAC
ATTTCTTTTCTTCTTATTCGCCCGTTTCTTACTTGACACTTTTCACCATT
TCCACACCTTTTCCAAACCCTGCGTAGTGTGGGCGTCTCTGTCGGTTATT
CTCCTGTACGAGTAATATCTGTATTAAACTACCTGTATTCAATCCC

Sequences in the Contig:

SY0AAC26YH17FM1 SY0AAC26YL06FM1 SY0AAC27YL15RM1
SY0AAC3YP15FM1 SY0AAC42YA24FM1 SY0AAC7YK04FM1
SY0AAD19YN06FM1