Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4154
Length(NT) : 650
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_09779
Accession: ref|XP_001227706.1| Score: 215 E_value: 6e-16
KEGG Definition: hypothetical protein
Accession: fgr:FG11425.1 Score: 211 E_value: 9e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4154
TTGGGCCAGAACCTCGCCTTGAATTCTGACATTCGGCTCATAGCCGCTCA
ACCAAACCTCAGCGCACATTATTTCCCATCGCCTACTATTCATCCAGCAC
ATTTCAGATATTATGGCACAGGAATCATCACAGAACCAAGTGCTTGCTGG
GAATATCAACTCTTTCAATGTATCAACCAATACTAACAACAATATTTTCA
GTGTCAGCATCGGCGCAGATGAGAGGGGTCGGATTCTGGAGTGGCTATCG
CCACTGGACCCTCGGAACAGACATCAAGGGGTGAGCAGCGATCGCCTTGA
CGGCATAGGGGATTGGCTTCTCGAAACCAGCGAGTTTCGGGAGTGGCGAA
GTAGTGAAGTTGGGTCTACTGGCAGTAAGGCCGTCTTGTTCTGCTATGGC
AATCCGGGGGTGGGGAAAACGTACCTTAGTTCCCTAGTGATTGATAGCCT
GTGCAAGGAAGATGGAAAAGAGAGGGTCGTTGCGGGTCTCTACTGCGATT
TTCTCGCCCAGAACGAACAGACCCCTGTAAACATGTTGGGTGCCGTTCTC
AGGCAACTTGTCGGCGGAGAAATCCCAGATCATGTACACCAGGCTTTCCG
AAAAGCAAAAAAGGAGTTGGGTGGCCGGCGTTCGGGGCTTCCCGATCTAG

Sequences in the Contig:

SY0AAC26YH15FM1 SY0AAC38YP06FM1