Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4152
Length(NT) : 1454
Best Gene Model Blast : Link to GSTUMT00001473001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein AN4978.2
Accession: ref|XP_662582.1| Score: 522 E_value: 6e-51
KEGG Definition: hypothetical protein
Accession: ani:AN4978.2 Score: 522 E_value: 3e-51
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0105 Score: 335 E_value: 6e-32
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 148 E_value: 3e-10
Swissprot: P78814|SRP2_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0046982 = Molecular function: protein heterodimerization activity

Sequence:
>Contig4152
TTGGATTCCATCTATTTCCACCCACAACCCTTCATCAGACTTTTCGGTCA
AGCATGGCGAACGAGTATTCGGGAACACGCTTGTACTTGGGCAATCTCCA
CAAGGACGCTCGCAAGCAGGAAGTCGAGGATTTCTTCAAGGAACATGGCA
GTGGAAACATCGTCGAAATTAAACTTATGAATGGGTTTGGCTTCATCCAA
TACGACAGCGAGGCAGATGCGAAGGATGTTGTGCCTGCCTATCATGGCAG
GGATTTCAAGGGTCAACCTTTGACTGTTCAATTCGCTCGCGGTAGTCGAC
ACAACCCTCGTCATCACGATTTTCCGGGCGGCGCGGACCGCACTTTTCCT
CGTCCTAGACGTACTGCGTTCAGAATGAATATTTCTGGACTTAATCCCGA
TACCAGCTGGCAGGATCTGAAGGACTTTGCTCGCAAGTCCGGCTCCGACG
TCGTTTTTTCCGAGGTCACCCGTGAACGTGACGGCCGAGGCATGGTTGAG
TTCGAAACCCACGATGATCTGAGGCGTGCAGTTGCTTTTTTGGATCGCAC
GGAGTTCAAGGGAACCCAAGTGTCCTGTACCCCCGACGTACTAGCGGATC
ATGATGTCCCTCGTGGACATGGCCCCGGACGTCGTTCTGTTTCACCTAGA
GGTTACGGTGGCCGTCGTTATTCCCCTAATCCTTCTAGGGGTTATCATTC
ACCACCTCGTCATAGCCGTCGTTACGAATCCCCTTCCAGGGGCTATCGCG
AGCGCTCCCCTCGTGGGGGGCGTGAGCCCTACTACAATGGTGGTGGTGGA
GGCCGTGATAGATCTCCGAGACGCCTTCCTCCCCCAGCCGATGACTACCC
CCCTCCTCGCGGCGGCGGATATGGTGGACGTGGTGGTGGCGATGACTACC
CTCCTTCGAGAAACGGCAATGGATACGACGATGATTATAGAGGTACGAAT
GGGTCGGGCAGGAGGCATTACGATGAATCCCATAGAGGACGTCCGGTGAG
TCCTCCTTATAGAGGCAGGAGTCCTCCACCAAGAGGGCCACCACCACGCG
GGTACGATGATTATGATCGTCGTCGTTATTGAAATTTTTTTGAAGAAAAT
TGTTGGAGACACCCCAGCACTCATGATTGCTTCATGAATGAGATGGTATA
GTTTCGGGGAAAAAGGTTCGCGATTATTTTTCGGGATGGTAGGGGACCTG
GCAAATAGGGGTGGCAATGGGAAGGGTTGGAATGTCTATTGTTTCAAGTT
TCTGTTTTCTACTCTTTTTTACTTCACAAAGTTCTGATTTTTCGATTTTT
TTTCTCGCCTAAAAAAACCTTTCGCTTTACTTTATGGCCTGGTCTTAGCT
TTTTCGTGGTGGTTTCCCTTTTGATTTCCCTTTTGATTTCCTGCTCTGTG
CCTTTTCTATTCTATACGTTTTGTAAGGAAAGTCAATGAAGTGAAGTTCC
TACG

Sequences in the Contig:

SY0AAA17YD14FM1 SY0AAA22YG03FM1 SY0AAA24YH24FM1
SY0AAA24YH24FM2 SY0AAA27YO05FM1 SY0AAA41YG13FM1
SY0AAA44YO10FM1 SY0AAA44YP13FM1 SY0AAA48YN23FM1
SY0AAA57YO09FM1 SY0AAA62YG08FM1 SY0AAB14YL07FM1
SY0AAB30YD22FM1 SY0AAB41YG02FM1 SY0AAC22YP22RM1
SY0AAC26YG17FM1 SY0AAD46YI22FM1 SY0AAD62YB07FM1