Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4150
Length(NT) : 1410
Best Gene Model Blast : Link to GSTUMT00010128001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: SH3 domain protein, putative
Accession: ref|XP_001269080.1| Score: 306 E_value: 6e-26
KEGG Definition: hypothetical protein
Accession: ani:AN1099.2 Score: 306 E_value: 3e-26
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1144 Score: 136 E_value: 8e-09
PFAM Definition: BUD22, BUD22. BUD22 has been shown in yeast to be a nuclear protein involved in bud-site selection. It plays a role in positioning the proximal bud pole signal..
Pfam Number: pfam09073 Score: 112 E_value: 4e-06

Sequence:
>Contig4150
TTGGCAATAGGATACCTTCCAGCAGAGCATATTGAGACACCTACGGAGCG
ATTGGCACGCCTTAACAAGCATCGCAATATAGATCTGGCATCAAACATGC
TTAGCGATAATGCTCACGAGAAATCAAAGAACCCTCTTCGGAAGGCTATG
CGCCGTCGTAATGCAAAAACTGTCACCTTCAGCCCTCCGACATATGTCGA
AGCATCGGAATATGAATACTCCACCGACGAAGAGGAAGGGGAGCGCGACT
ATTATGCTGAAGATGAGGGGCAAGATCAGGAGAGGGGCTCTAATGATATT
GAGCGTGTAGATTCCGGTGGAAAGTCTAGCGATGAGCGATCTAGATCGGG
GTCAGATTCAAAGAATAGTAGTGACATTTCTCGGGATGATGGGGATGTAA
AAGTCCGAAAGAACCCCGCTCCTGCTTCTTTGAGACATCCCGACTCGGCT
GTATTTAGTGACGACAAAACCGAAACCAAGAAGCTTACTCTGACCCCAAA
TCTTCTGCGCGACGATGCCACTACCTCAGTTGATCACGTTCGAGGTCGAA
CTTCAATAGAAAAGTCGTCGAAGCGGGACGATGGTATTACCTCGCCTCAA
CCTGGTAGCAAGGATTCCAGGAAGGCGAAGAAGGGTGGAAGTGTGCTTGG
TAACTTGTTCAAGAAGAGGAACAAGAAAGGGAGAAAAGACGAGGAAGACG
ATCTGGAGGAGTGGCTCCACAGCGGTGATAGGGCTGATAAGCAGAACGCC
AGCATCAGTTCAAGAGAGTCTGAGGATAGCCAAATGGAGAGTGTGAAGAA
GGATAAGGAGGAATTTCACCGGCGTGAGGAACAACGAAGACAGCAAGCTC
AGCAAACCCTGCGGAAGCAACAACAGCAACGGGAAGGCCCCCAAAAACCG
ACCGTCAACACCGGAGCACCTTCGACAATACGCAGGGTTGAGTCTGGTGG
TTCGCCAAATAGTGCCGATAGGGAGAATAAGGGCGATGTGGTTCATGGCC
CGACAGCTCAGCAAAAACAATCCATTGAGCTTTACCGTAATGATTCCGCC
TCCAAGCCAGTTGCTGTATATGCTCCTTCCGGTCGAAAGAGGTCTACATC
ATCTGAACGTCGAAGCGGGGAAACAGATAGAGGTCCCCCAGCTGAGGAGA
AACCTGTTACTTTATATTCTTTTGCCGAACCAAAGGCCTTAGAAACCGCC
GCAAACAATGAAGCGGTTCGGAAACCTTCGGAGGACAACATCAAACCAGC
ATATGTTCCAAACACTTACCAACCTGCTCCACAACCCAGTGATTCCGGCA
GCAGTGGGAATGGATCCGGAGTTAGTAATAGTAACAATGCTCACCAGTTC
CAGGAACGCCTTTCTGAATCGCCCGAGCATATTTCATACCATGATGCTAT
TTCCGACCGA

Sequences in the Contig:

SY0AAB28YM02FM1 SY0AAB50YH15FM1 SY0AAC26YF19FM1
SY0AAC56YK01FM1 SY0AAC5YE20FM1