Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig415
Length(NT) : 872
Best Gene Model Blast : Link to GSTUMT00005090001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: nucleolar protein
Accession: ref|XP_001559651.1| Score: 915 E_value: 8e-97
KEGG Definition: ribosome biogenesis protein - Nop58p/Nop5p
Accession: aor:AO090012000796 Score: 908 E_value: 2e-96
KOG Definition:
Classification: [RNA processing and modification, Translation, ribosomal structure and biogenesis].
Kog Number: KOG2572 Score: 897 E_value: 3e-97
PFAM Definition: NOSIC, NOSIC (NUC001) domain. This is the central domain in Nop56/SIK1-like proteins..
Pfam Number: pfam08060 Score: 249 E_value: 3e-22
Swissprot: Q12499|NOP58_YEAST
Gene Ontology:
GO:0031428 = Cellular component: box C/D snoRNP complex
GO:0032040 = Cellular component: small subunit processome
GO:0017069 = Molecular function: snRNA binding
GO:0000154 = Biological process: rRNA modification
GO:0006608 = Biological process: snRNP protein import into nucleus

Sequence:
>Contig415
TTGGATCCAGCAACCACACCACCAAGATTAAACGTCCCTCGCTGTCTCAC
GTCAATTTTTCTCCACCGACACGAGGATCGCTAAATAATGACCTTCCTAA
TTCTCACTGAGACTAGTGCTGGCTACGCCCTTTTCAAAGCGAAGGACAAG
AAACTTCTCAAGAAAGATGACCTGGCTAAAGAGATGAGCACCCCCGAGGG
CGCTGCTAGTTTAGTGAGGTTGAAACAATTTTCAAAATTCGATAGTGCGG
CAGCTGCTCTGGAGGAGGTATCATGCATTGTGGAGAATAAGGTGTCTCCT
ATGCTCTCTAGTCTATTAAACTCGGTCAAGGATGAAAAAAAGGCATCTCT
CGTTGTTGCTGATCCAAAATTGGGAAATGCCATCAACAAACTTCCTGGAT
TGTCGTTTCAAATTATCTCGGATTCCTCTACCAATGACCTATATCGAGCA
ATACGCGAGCACCTTACGGCATTGATTCCAGGCTTGACTCCTAACGATGT
TTCTACTATGTCATTAGGTCTATCACATTCCCTGTCGCGGCACAAGCTCA
AGTTCAGTCCTGACAAGGTCGATACCATGATCGTGCAAGCAATCGCACTT
CTCGATGACCTTGACAAGGAGCTTAACATTTACGCAATGCGCGTCAAGGA
GTGGTATGGGTGGCATTTCCCTGAGATGGGGAAAATTATCAACGATAACC
TTGCCTATGCCAAGGTTATCAAGGCTATGGGCATGAGAACCTCTGCCGCT
ACAACAGATCTTGCGGAAATCCTTCCGGAGGAGATCGAAACTGCCCTCAA
GGCAGCAGCAGAAGTTTCAATGGGGACCGAAATCACAGCTGAGGATCTCA
ACAATATCACACTACTCGCAGA

Sequences in the Contig:

SY0AAA23YI11FM1 SY0AAA44YC02FM1 SY0AAC34YK24FM1
SY0AAD40YM11FM1