Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4148
Length(NT) : 1462
Best Gene Model Blast : Link to GSTUMT00010424001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SS1G_12221
Accession: ref|XP_001587191.1| Score: 1000 E_value: 1e-106
KEGG Definition: hypothetical protein
Accession: ani:AN3176.2 Score: 926 E_value: 4e-98
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0345 Score: 1022 E_value: 1e-111
PFAM Definition: DEAD, DEAD/DEAH box helicase. Members of this family include the DEAD and DEAH box helicases. Helicases are involved in unwinding nucleic acids. The DEAD box helicases are involved in various aspects of RNA metabolism, including nuclear transcription, pre mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression..
Pfam Number: pfam00270 Score: 376 E_value: 1e-36
Swissprot: A7F2S3|SPB4_SCLS1

Sequence:
>Contig4148
TTGGAGCCTACCACGCTCTCTAAAAAGGAGAACGGCTCGATCGCACATCT
ACTTGAGTACTGGTATCCATCTATCCATCTCCCCACCACCATCACCACTG
CTGCCGGAAAAACCAATCATGTCATCCAAAAAGAACGCCAAAAAGCACAC
CCTCTCAACAGTATCCTCACCGCCACCATCACTATCATCACCACCAGGGC
CCATCACATCAAACCCCCTCACCAACGATCCGCAATCCTGGACATCTCTA
AACCCCCCACTATCTCCATGGCTCCGCATAGCCTTGCAAACCCTCTCTTT
CGAGCGCATGACGCCTGTGCAAGCAAGCACGATTCCCCTCTTCCTAGGAA
ACAAAGACGTAGTGGTCGAGGCGGTCACCGGTAGCGGGAAAACTCTCTCC
TATCTCCTCCCTCTCATTCAACGCCTATCCAGCGCTCCGCGCCGGAAACA
CAATATTGGTGGGATAGTCATTGTCCCGACGAGGGAATTAGCCGGGCAGA
TTTTCTCCGTCTTATCCTCTCTATTGCAGTTCCAGCCTCCCTCGGAGACT
GGATTGAAAGCGCAGTTGTTGCGTGGTGGCGAAGGCAACACCCGAAGCGA
CTTGCAAGCCTTCCTGCGCGACGGCCCGAACATTCTGGTGTGCACGCCAG
GCAGGTTGGAGGAGTTACTAGGGAGTCGATATGTAGTCGTTTCTGGCGAG
ACCTTTGAAATGCTTGTGCTGGATGAGGCAGACCGGTTGCTGGATTTGGG
GTTCTTGGAGGTGCTTGCGCGGATCATGTCCCGTTTGCCGAAGCAGCGGA
GGACCGGGCTTTTTAGTGCTAGTGTTACGGAGGCCGTGGTTGGGGGTTTG
GTTAGGAGTGGGCTTAGGAATCCGGTCAAGGTCGTTGTGAAGGTTAAAGA
GAGGGAGGTTGAGAGGAGGGTCCCTGTCAGCTTGGAGAACAACTACATAA
TAGCAACCCCTCCTTCCCGCTACCCACACATCCAACACATCCTCACTACC
ACCACCCCACAACCCCAAAAATCGATAATCTACCTCCAAACGTGCGCAAG
CGTAGACCTACACATAATCCTCTTCCGCCTCTTCATCCCGAAAGAATACA
CCCTACTCCCCCTCCACGGCCATCAATCCCCTCCCCAGCGAAAGCGAAAC
TTTGCCGCTTTCATAACCTCCACAACCCCCACCATTCTCCTGACCACCGA
CCTCGCCGCGCGCGGGCTAGACATCCCAGAGGTAGACCTGGTCCTACAAC
TCGACCCACCCACTGACCCAAAAGTCTTCCTCCACCGCTGCGGGCGCGCC
GCACGCGCTGGCCGTCGCGGTCGCGCCATCCTATTCCTATCACCGGGGCG
CGAGGAGGAGTATATTTCCTTCCTGTCTATAAGAAAAACCCCCGTCACTC
CCTTCCCCTCTCCCTCACCCTTAGAATTATCAAGCACAACGAAATCCATA
ATAGAGAAGTTT

Sequences in the Contig:

SY0AAA18YJ18FM1 SY0AAA29YN20FM1 SY0AAA58YK16FM1
SY0AAB56YF07FM1 SY0AAC26YF16FM1 SY0AAC41YI11FM1
SY0AAC7YM15FM1 SY0AAD25YH10FM1 SY0AAD53YJ17FM1