Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4146
Length(NT) : 685
Best Gene Model Blast : Link to GSTUMT00005432001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU06663
Accession: ref|XP_960910.1| Score: 397 E_value: 6e-37
KEGG Definition: hypothetical protein
Accession: ncr:NCU06663.1 Score: 397 E_value: 3e-37
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3144 Score: 234 E_value: 1e-20
PFAM Definition: PIG-F, GPI biosynthesis protein family Pig-F. PIG-F is involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis..
Pfam Number: pfam06699 Score: 246 E_value: 5e-22
Swissprot: Q871U9|GPI11_NEUCR

Sequence:
>Contig4146
TTGGCACCACCTCAACAACAAACACACACCAAAAACAAATGCCAACCGCA
AAAACCCACCCTCGACGCACGGGTCCTACTTCCGCGATGCGCGCGATGGA
GCCACACATATACACCGCAATCCTGGCAAGCACCTTCATCACCGCCTTTC
CAAACCTGGTTTCTGACCCGGCGAGCACACTCCTGTGGACGCTCCCGGGA
CTAGCACTTTTGCAAGCAATCTATCAAGTCCGCTGCCTCCGCGTGCTGAA
ACCTGCTTCCCCGTCGGGGACGGGGAGGAAGGAGGGTATGGGCGTCAGCA
GCAAGATAATTTCATCGTTCCTAACAACCCTCTTCGCAACAACGATCGGC
ACGGCAGCGCTCTACGTACTGCTCGTGCTCTTCGGTGCCCCTGTGACGAC
GCATGTACTCCCCACACTGCTGTGCGCGATGCATGCGTCGTTGCTGGCGG
TTGCACCGTTGGTGTATAAGTATCGCCTCGAGGGCAGGATCTGGAGAGAG
ATTCTGGGAGGGAGGGCCGTTATCGAGGAGTGCTTCGCTGGTGCTGTCGG
CATGTTGGTGGGTGCGTGGGTTGGGGCCGTGCCAATTCCTTTGGATTGGG
ATCGTGAATGGCAGAAGTGGCCGGTTACTATTGTCACCGGGGCGTATATC
GGATACACGGTTGGGAAAAGCTTGGGCTGGGCGTA

Sequences in the Contig:

SY0AAA11YN20FM1 SY0AAC26YF10FM1 SY0AAD41YE22FM1