Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4145
Length(NT) : 908
Best Gene Model Blast : Link to GSTUMT00011086001 E-value : 1e-94
Numbers of ESTs : 27

Blast Results:

Nr Definition: hypothetical protein SS1G_10335
Accession: ref|XP_001588788.1| Score: 228 E_value: 4e-17
KEGG Definition: predicted protein
Accession: mgr:MGG_04105 Score: 225 E_value: 4e-17
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1773 Score: 225 E_value: 2e-19
PFAM Definition: UPF0057, Uncharacterized protein family UPF0057..
Pfam Number: pfam01679 Score: 194 E_value: 7e-16
Swissprot: Q4WYA5|PMP3_ASPFU
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig4145
TTGGGTTCAGTGAACCATGACGTAACTTATTCCTGGATGACGAACCCGCC
CTGCACCAGCCACATCGCACCGGGATAACCGGGCTTGAAATTCGGTGGCG
GGTGGGCACAGTACTCGTACAAGTATCTACGAGTATGACGTTTGGTCTCG
AGAAGTTTTTTTTTTTTGTGCGAGCCCACCCTTTTCTTTTCCTTCCCATT
TCCCTTGAGCACTACAAATAAAAGGCCTGGGTGTCCCATCCCCCCTTTCC
TCTCTCATTCGTTTGGGCGATACGTGATACCCAGTACAGCTTTGCTCCTT
GAACAAACTTGACATTTTATCGAAACCAGCATCGAACCGCTTAAGCTTAC
AAACTACTGCTACGACCAACCAACCAACCACAACCACAATCACAACCACA
ACCACAACAAACACCATCATGCCTTTCACCGCCAGTGATGTTTGCAAGAT
CCTTCTCGCTATCCTTCTTCCTCCTCTTGGTGTCTTTCTGGAGAGGGGAT
GCAGCGGTGATCTATTGATCAATATTATTTTCACCTGCTTGGGTTACTTG
CCTGGCATCATTCACGCCCTATACATTATATTTAGGTACTAGAGAGACGC
GAAACCCCCACGATCCTTATTTCCTCGAGCACAAACAACGTCGGTCAGTG
GAAAAGATATGGTAATTCTTGAATTGATACCGTCTGGGAGGGCGGTCATT
GTCTGCCGGTCGGTCTTTACATGAGGAGTGTTTCGGGCCAAAAATGTCGG
GCTCTCTCCTTCTCTCTCTCTTTTGTAGTTGCGAGCATGGGTCTTTTTTT
CGGCTTGGTTTGGTATTCGTTTTTCTTCCCCTTTTTTCTCTTCTCCCTGT
TTGTATGACTACAATATCATGATAGCGATGACCTGAAATTTGCAAATATT
TCTCCCGG

Sequences in the Contig:

SY0AAA34YD01FM1 SY0AAA38YB14FM1 SY0AAA38YD04FM1
SY0AAA38YJ01FM1 SY0AAA58YN12FM1 SY0AAA7YH10FM1
SY0AAB27YB01FM1 SY0AAB32YL10FM1 SY0AAB39YG06FM1
SY0AAB3YF02FM1 SY0AAB48YC15FM1 SY0AAB53YN02FM1
SY0AAB54YM24FM1 SY0AAB58YI14FM1 SY0AAC14YC10FM1
SY0AAC25YJ24FM1 SY0AAC26YF02FM1 SY0AAC39YJ20FM1
SY0AAC48YG10FM1 SY0AAD31YK21FM1 SY0AAD40YG15FM1
SY0AAD41YM04FM1 SY0AAD43YD04FM1 SY0AAD43YI23FM1
SY0AAD44YD10FM1 SY0AAD58YJ09FM1 SY0AAD6YD23FM1