Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4144
Length(NT) : 1596
Best Gene Model Blast : Link to GSTUMT00010261001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein BC1G_10364
Accession: ref|XP_001551107.1| Score: 1159 E_value: 1e-125
KEGG Definition: Hsp90 co-chaperone Cdc37; K09554 cell division cycle protein 37
Accession: afm:AFUA_4G10010 Score: 1097 E_value: 1e-118
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG2260 Score: 460 E_value: 2e-46
PFAM Definition: CDC37_N, Cdc37 N terminal kinase binding. Cdc37 is a molecular chaperone required for the activity of numerous eukaryotic protein kinases. This domain corresponds to the N terminal domain which binds predominantly to protein kinases and is found N terminal to the Hsp (Heat shocked protein) 90-binding domain pfam08565. Expression of a construct consisting of only the N-terminal domain of Saccharomyces pombe Cdc37 results in cellular viability. This indicates that interactions with the cochaperone Hsp90 may not be essential for Cdc37 function..
Pfam Number: pfam03234 Score: 476 E_value: 3e-48
Swissprot: O94740|CDC37_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0031072 = Molecular function: heat shock protein binding
GO:0042803 = Molecular function: protein homodimerization activity
GO:0006457 = Biological process: protein folding
GO:0051726 = Biological process: regulation of cell cycle
GO:0031098 = Biological process: stress-activated protein kinase signaling pathway

Sequence:
>Contig4144
TTGGGCGAGGGTCTCTCCTCCCCAGAACTCCTTCCCTACCTATACCCATT
CTATTATCCTAATAATATAATATTATCATTTTAAACTCCTCCCTTTGCAC
CTCCTTCACTATAAGTCGCGCAATAATTGCTATTGAACACTTCCTCTTAA
AATACGGTTCTCCAGTGGAGCTGATCTAATCACCCCACCTTACCTTCCTC
CCCCATTCACCTACTTACGCCCCCCTATTGACCAACAATCATGGTTCTCG
ACTACTCAAAGTGGGATAATATCGAACTCTCCGACGACTCCGACATCGAA
GTCCACCCAAATGTCGACAAGCGCTCTTTCATTAATGCCAAACGGCGACA
GATTCACGAGCAGCGCGCTATGCGAAAGCAGCAGATTACGAACCTTCGTA
CCGAGCGTTCGATGAACAATGCTCTCCTCTCCCGTGTTTCGCAGCTTATA
TCCACTTTGGACGCCGGGTCAAAAGGCTCTAAATCCCCTGAAGAAATCGT
TTTCCAATCTCTCATGGATATCTCTTCTGCCGATAATAATCCTCAGGAAT
TTACTCCCCCGGAGGGCGCTCCTTCGTATGCACAGATGATGGCCTCGCTT
GTCGATTCCATAAAGAAAGAGATAGACGAGGAGAACCCGGATGACCGCTG
GACCTCCTTTTTGAACAAGCTCAAGGAGCATAAGGTTAAGCTCACAGGTG
TATACGAAGATTCTGGAAAGAGATTGGCAGACCTGGAGAAGGAAGACAAT
GCAAAAATCACTAGTGACAGTATTCACGACGGCTTTTCCTCCGGACACGT
TACCAAGGAATCTCCGCTTCCGAAGAAGGAACCAGCAAAGAAGACGCAGA
AGGTTCAAGCGGTTGAGCAACTTAACCCGGGTGTCAAGGCTAAAGGGCCG
CTGGCCACAGATCCACCCTCCGATGCCGATGCCGAAGAGGGCGGCGATGA
GGCTGATGAAGACGAAGACCACATTGAGCCAACAGCGCTTGGCAGGGAAT
TCTCACATATCAAAATGGGCGACTACCGCGCATGCATGGAGTTTATCTCC
CGTAATTCAGCTGTTGTCGCGGAGAAGGAAACCGATGGTCTTCTGATCGA
AGCTTTCAACTCGCAAATCGCCGGGAAAGAAGACTACGCAAAGCAATGCG
TCCACCAAGCTCTCCTTCTACAGTACTGCCGCCAACTCGGTCGCGATGGA
ATAGCTCTATTCTTCAGAAGGATAACCACCCCAAACCACCAAGCCCAAAA
GGTCTTCCACGAAGACGTTACCACAACCTATGCACGGATCCGTGAGCGCG
CAGCAGCAATCGCAACCGAGAGCTCAAACGAAAACGCCGAGCAGATCCAA
CTCCATGCAGTCGACCCGAACACTCAAATCTCAATCGCTGTACCATCGGT
CGACAGCGAGGATCCTGACATCCAAAAGTCCCGCACAATCTTCGAATCCT
TCCCTCCCGGACTACAACGTGCTCTGGGGAGCGGTAGTCTGGACGAAGTG
AACAAGGTCCTCGGTAAAATGAGCGTAGAAGAGGCAGAAGAGGTCGTGGG
ACAACTAGGAGAGGGGGGCATGCTATCTTTGGAACCACAGATTATC

Sequences in the Contig:

SY0AAA16YO16FM1 SY0AAA25YD20FM1 SY0AAA26YJ21FM1
SY0AAB1YC12FM1 SY0AAC26YE20FM1 SY0AAC56YB21FM1
SY0AAC58YD15FM1 SY0AAD17YC09FM1 SY0AAD43YB11FM1
SY0AAD50YH20FM1