Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4143
Length(NT) : 2193
Best Gene Model Blast : Link to GSTUMT00011006001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: DUF221 domain protein, putative
Accession: ref|XP_001269921.1| Score: 796 E_value: 1e-163
KEGG Definition: hypothetical protein
Accession: spo:SPAC2G11.09 Score: 512 E_value: 1e-100
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1134 Score: 614 E_value: 4e-64
PFAM Definition: DUF221, Domain of unknown function DUF221. This family consists of hypothetical transmembrane proteins none of which have any function, the aligned region is at 538 residues at maximum length..
Pfam Number: pfam02714 Score: 712 E_value: 2e-75
Swissprot: Q09809|YAB9_SCHPO
Gene Ontology:
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>Contig4143
TTGGGGAACTCTTCTGTTCCCCGTACAGAGGGCCAGGATGGCTATTCACA
CTTTACACGATGGAGTAACGCTCTTAAGGAGTAATAATGATACGCACATC
GGACTTCCGACAGATACGAGGAGGACCGATTTACCAACCCAGCTAGTTAT
CTCCACGACTCTTGGATTGGGTGCTTTCTTGACGTTTTGTTTCTTGAGGC
CAAGGTGGTCCTCGCTCTACGCGGCGCGGAAAAAGACACTTGATTCAGGT
GAGCTGAATGGGGATCTGAGGGCTGCGTCATTACCGAATTTACCAAAGAC
TTTCTTCGGCTGGATACCGGTGCTGTGGGAGATAACGGATGAGCAAGTAC
TGTCGTCTGCTGGTCTTGATGCCTATGTGTTTTTGTCATTTTTCAAGATG
TCTATTAGATTCCTATCGATTGCAGCTGTGCTAGCGTTGGGCTTGCTCAT
GCCTATACATCTGCACTTTGACCACTCGGTCTCGAAACCTCGGGTTTCGT
TTTCGGAATGGGCACTCAGACCTGCTGGTCGGGGGATGAATGTCCTTGGT
GGTAAAGATAAGGATGAAATCAAGCTTGATGGGCCATACCTTTGGGCTTA
CGTGGTGTTTGTGTACCTGTTCACTGCCTTAGCAGTCTATTTGCTTCTCG
ACCAGACCAAAAAGGTGCTTGCTGTCCGGCAAAAATATCTCGGGAATAAA
GTCACGGTTACCGATAGAACCGTGAGGTTGTCCGGGATTCCAAAAGTGCT
TAGGTCGGAAGATGCCCTGAAGGAATATATTGAAGGCTTGCGGATCGGAA
GAGTCGACTCGGTTACTATCTGCCGGAATTGGGCAGTGTTAGATCGTCTT
ATGGCGCAAAGGCGGGATCTCGTGAGACAGCTGGAAGAGGTATACGTCGT
TTACAGCAGGCATCGCAAAGTTGGGAGAGATTTGGAAGCTCTGCCTTTTA
TCCAACCATCACCCCCACAACCGTTACAACCGGGTGATGAGGAAACACAG
CCACTTCTTAACCGGGGCCCTCGTCCTTCTCGTGGGGATGATAGGCCAAA
GATGACGATACGGGTTGGGCTATGGGGCCTGAAGAGAAAGAAGGTTGATG
CAATCGACTATCTTAGGATGAAGTTAAAGGCACTTGATGAAGAGATTATT
GAGGCTAGAAAGAAGGAATATGAACCCAGTTCCAATGCATTTGTTACCAT
GGAGTCTGTTGCATCAGCTGCAAGTTGTGATTCAAGCTGTTCTGGATCCG
CGCGCCAACCAAATGACAGCTACCCAAGCACCCGCGCCGCCGGATATCGT
CTGGAAGAATACCTATAGGTCCCGCAGTACTCGTCTGATTTATTCATGGG
GAATCAGTATCCTTGTCAGTCTACTTTCAATTGTCTGGCTTATACCAGTC
ACTGGTCTTGCTGGTCTTTTGAACCTTTCAGATATCCGTCGGGTTTTGCC
TGGGCTTGCAGATCTTCTGGAGGGCAGCCCTATTATTAGTTCCTTGATCC
AGAACTTCTTGCCAACCGCGGTTTTGACACTTTTCAGCATCCTCGCGCCA
TACTTCTATGACTGGCTTTCAAACTGCCAAGGCCAAATCTCACAAGGAGA
CGTTGAGCTTTCACTAATCAGCAAGAATTTCTTCTTCACGTTCTTTAATG
TGTTTTTTGCCTTTACAACCCTCGGAACCGCCTTTACCTTCAATAACCTG
TGGGAGCAGCTCAAGGGCTCACTCTCCGATACCACAACCATTGCATATGC
GCTGGCGCGGTCCCTTGGAAATCTTGCTTCTTTCTACGTGAACCTAATCA
TCCTTCAAGGAATCGGTATGTTTCCGTTCCGCCTCCTCCAGTTTGGAAGT
GTAGCTCTTTATCCTATCATGTACGCCGGGGCGAAAACGCCTAGAGATTT
CGCCGACCTTGCCAGGCCCTCGACGTTTTCTTACGGGTTCTACCTGCCGC
AACCTATCTTGATTCTCATCATCTGTATCATCTACAGCGTTCTGCCCGCT
GGAGGGTTAATTCTTGGGTTTGGTTGGGTATACTTTGTCATCGGATACTT
TACATACAAATACCAACTCCTATACTCAATGGACCACCCCCAACATTCCA
CAGGTCAAGCTTGGAGCATGATATTCTACCGCGTAATACTCGGACTTTTC
ATCTTCCAGCTCGCCATGGCTGGCTTCCTTGCAATCAATCACG

Sequences in the Contig:

SY0AAA42YG04FM1 SY0AAB42YC13FM1 SY0AAC13YA12FM1
SY0AAC26YD20FM1 SY0AAC32YH19FM1 SY0AAC41YF19FM1
SY0AAD27YF04FM1 SY0AAD38YJ08FM1 SY0AAD48YJ09FM1
SY0AAD57YH14FM1