Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4142
Length(NT) : 934
Best Gene Model Blast : Link to GSTUMT00008972001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_00083
Accession: ref|XP_001790779.1| Score: 338 E_value: 7e-30
KEGG Definition: hypothetical protein
Accession: ang:An12g09270 Score: 325 E_value: 1e-28
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 126 E_value: 7e-08
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 155 E_value: 3e-11
Swissprot: P07921|LACP_KLULA

Sequence:
>Contig4142
GGACCAAGTGTTGAAGTTGATATTACTTGTACAAGCTATGGTAACGACAG
ATACGGTACTCCCGACGCACCACCACCACCACGGATACACGGGTCTGAAA
AAGGAAAAAGGAAAAAGGAAGAAAAAAAAAAGGAAAAGAAAAGGAAAAAA
GGTACAGAATATACATTCAAGAGTAGTATTATTAGGGCTTTTGTAACGCT
GTCAACAACAACAATAGTAAAAAGCCACCCCCATACCCGCCGGAAGAAAG
GGAAAAGAAAAGGGATATGATGATACAAAACACATACACAACACGCAAAC
TCCTGGCACGCCGCCCAGCCCGCTCATTGGAATAAGCGAGGATAAGGATA
AGGGTAACGGGAAAGAAAGAAGAAGAAAAAAACGTAAACTCGTTTCCTCC
GCGAAACACTTTCAAAATTTTTGCTCTGAAGGTGGTAGTGGTGGGGACTC
GAGGTTCTGCTGATCCCCTATTAATCCTTGGTACAATATCCCACTCTCCG
TCACGATAATGGAGTGCTTCTGTAAGGACTTGTTTCGTGGCATAGGGTCC
TTGAAGATCTCATTTATTTCTTCGAGGGTTCTCGCGCGAGTCTCGACAAA
GAAAAGATAGATGACAATCAACTCGAGGATGTCCCAAGCAATGTAAAGAA
AGCAAAAACCCCAACTGGTCTTCCCAATGAAGACAGAAATCCCATAAGAA
TTGAACAGCGTAGCAATGTTGGTGAAGAAAGCGAACACCCCCATCCCCTT
AGCTCTGGTCTCGTACTTCAGACACTCGACCGGATACAGCGCTTGCAGAG
GCGTATATGAGACCGAGTAAGTGATTCCAAAAAGGTAGATGAAAGCTATG
GTAGCCGTGCTGCCCGCGGTGTTGGTGTTGGATTCCTTCCCAAAGTAGGA
CGTCAAGATTGTGATCACGGTCCACCAGGCCCAA

Sequences in the Contig:

SY0AAB27YN16FM1 SY0AAC26YB23RM1