Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4141
Length(NT) : 1016
Best Gene Model Blast : Link to GSTUMT00005402001 E-value : 1e-156
Numbers of ESTs : 23

Blast Results:

Nr Definition: hypothetical protein PGUG_01527
Accession: ref|XP_001485856.1| Score: 603 E_value: 1e-60
KEGG Definition: AFL039Cp
Accession: ago:AGOS_AFL039C Score: 597 E_value: 4e-60
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1651 Score: 585 E_value: 4e-61
PFAM Definition: GSHPx, Glutathione peroxidase..
Pfam Number: pfam00255 Score: 440 E_value: 3e-44
Swissprot: P40581|GPX3_YEAST
Gene Ontology:
GO:0005622 = Cellular component: intracellular
GO:0004602 = Molecular function: glutathione peroxidase activity
GO:0047066 = Molecular function: phospholipid-hydroperoxide glutathione peroxidase activity
GO:0008379 = Molecular function: thioredoxin peroxidase activity
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>Contig4141
TTGGGAGAGATTTGTCACCTCCCATAGCCCAGAGCCCGTTCGAGTACGGG
TACGAGTAGGGTACTCGAGTAGGTAGCTGCCATGGTTCCGGTTCCCGACC
TCCATCCGGCCATCTGCAGACCTCCTCACCCAACTACGACACCTCCCCCC
CTACAAGCTCCCTTAAAAACCTCCTTCCATCTTCCTCCAGAAGCAAAGCT
CAACGTCACTGATTGTTACCAACAACATCACTACACCTTTCGCAACAATA
AACACACGAGATCTTCTAACTCTACATAACAAAGATCATGTCTTCCGCTA
CCACTTTCTATGATCTTGAGCCCCTTGACTCTAGAAATCAACCCTATACC
TTCAACCAGTTGAAAGGGAAGGTGGTTCTCATTGTCAATGTTGCTAGCAA
GTGCGGATTCACTCCCCAATACGAGGGCCTTGAGAAACTTTACGAGAAGT
ACAAAGACCAGGGGCTCGAAGTGCTTGGTTTCCCGTGTAACCAGTTCGGT
GGCCAGGAGCCAGGGACAGACGAGGAGATCCAAGATTTCTGCATGGTCAA
TTACGGCGTTAAGTTCCCTGTTCTCGCCAAGATCGACGTCAACGGGGGTG
ATGCTTCTCCGGTCTACAAATGGCTCAAAGATGAGAAGGCGGGCCTTTTG
GGAATAAAGCTCATAAAATGGAACTATGAGAAATTCCTCGTTTCCAGGGA
AGGAAAGGTGGTTGACCGCTATGCCTCCACTACGAAGCCCGACTCGTTGG
CCTCTGCTATCGAGAAGGAGCTCAATAAGGGCACTCCCCCGAAAGCTGAA
TTGTAGCTACGCGCGGGGATGACTCGTGGTGGTTTTTCTCTGCATTCGCG
TGTTTTGTAACAGTAGGCTCCGGTGGTAGGCTTAATAGCGATCGTGCAAA
GAATTTGTGGTTCGGCGAAGGTTGTTATACCTCGCCTTGTTTTTCCTTCC
GGATGCGCTGGAATCGTAGTTTGGGCATCGCTGTGGAGTAGGACAATCAG
ATATTATATCTCCCTG

Sequences in the Contig:

SY0AAA23YH21FM1 SY0AAA27YI03FM1 SY0AAA30YM22FM1
SY0AAA40YE07FM1 SY0AAA55YM17FM1 SY0AAB20YK22FM1
SY0AAB8YJ24FM1 SY0AAC14YI23FM1 SY0AAC21YK12RM1
SY0AAC26YB21FM1 SY0AAC27YN22FM1 SY0AAC30YP02FM1
SY0AAC41YF14FM1 SY0AAC50YC03FM1 SY0AAC59YP23FM1
SY0AAD10YA19FM1 SY0AAD19YD14FM1 SY0AAD1YD16FM1
SY0AAD22YH14FM1 SY0AAD32YD21FM1 SY0AAD35YH18FM1
SY0AAD3YG24FM1 SY0AAD8YC03FM1