Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4140
Length(NT) : 168
Best Gene Model Blast : Link to GSTUMT00011318001 E-value : 3e-45
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4140
AAAGAAAGGAAAAAAAGGTCTAGCCCAATTACTTTTGTGGAGGTATATAG
AAAAAAAATAGTTTACAATACAAAGGGATTAACCGGAAGCACTCCCTACT
AGCAACATGTCCAACATCCCCACAACCAGGCTTGATTGTTTTGAGTTCTC
CACTTCCTGTTTGACGCG

Sequences in the Contig:

SY0AAC26YA23RM1 SY0AAC26YF13RM1