Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4139
Length(NT) : 690
Best Gene Model Blast : Link to GSTUMT00011318001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CC1G_00329
Accession: gb|EAU84810.1| Score: 396 E_value: 7e-37
KEGG Definition: hypothetical protein
Accession: fgr:FG10060.1 Score: 366 E_value: 1e-33
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0310 Score: 384 E_value: 5e-38
PFAM Definition: No Hit Found
Swissprot: O94365|UTP15_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus
GO:0005819 = Cellular component: spindle

Sequence:
>Contig4139
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTCACCACAAGCGTATTAA
TATTATTATAATTGATACCTTCGTTCGTCCCCCGCCCTCACTACTCGGCG
CTCCCTATTCATCTGTCTAGAAATCCCTGTCTTCTCTCCTAACAGCTGTA
GCCCACCCCAGCCAGCTACAGCTGGTCAATCATCTATAATCATGGCTGCG
CCAGTCACCCGTATGCCACTCGCCAGGCTGCCCGCTCTCCCCGCCGCCTC
AACTCCCGAGCAACGCTACTGGGGAACATTCAAGTCGCACCTTCTAATTC
AAGAATACGGAGCAATCAAATCTATCAATTTCTCCCCGGTTTCCCCCCAT
GATTTCGCTGTCACCGCCTCTACCCTCGTCAAGGTGTATTCATCGAAAAC
CCGAGTAGTGTCAAAGACAATATCGAGATTCCAGGCACCTGCGCAATCCG
GAAGCTTTCGCTCTGACGGAAGAGTTTTGGTTGCCGCTGATGACAGTGGA
CTGATTCAAGTTTTTGACATTGGCTCGAGAGCTGTCATCAAGACATGGGA
TGAGCACATGGGGAACACCGTTAGTGTTACAAAATTTTCCCCGACAATTG
TGACCCAAGTACTGTCTGCCTCTGATGACAAGACAGTTCGTCTCTGGGAC
TTGACCTCATCGAAGTCGACTCACAAATTTATCGGAAACC

Sequences in the Contig:

SY0AAA11YG08FM1 SY0AAA54YK08FM1 SY0AAC26YA23FM1
SY0AAC26YF13FM1 SY0AAD57YB12FM1 SY0AAD58YK13FM1