Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4138
Length(NT) : 1510
Best Gene Model Blast : Link to GSTUMT00008960001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59201.1| Score: 863 E_value: 2e-90
KEGG Definition: lysophospholipase [EC:3.1.1.5]; K01048 lysophospholipase
Accession: aor:AO090023000685 Score: 863 E_value: 9e-91
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1325 Score: 850 E_value: 1e-91
PFAM Definition: PLA2_B, Lysophospholipase catalytic domain. This family consists of Lysophospholipase / phospholipase B EC:3.1.1.5 and cytosolic phospholipase A2 EC:3.1.4 which also has a C2 domain pfam00168. Phospholipase B enzymes catalyse the release of fatty acids from lysophsopholipids and are capable in vitro of hydrolysing all phospholipids extractable form yeast cells. Cytosolic phospholipase A2 associates with natural membranes in response to physiological increases in Ca2+ and selectively hydrolyses arachidonyl phospholipids, the aligned region corresponds the the carboxy-terminal Ca2+-independent catalytic domain of the protein as discussed in..
Pfam Number: pfam01735 Score: 851 E_value: 9e-92
Swissprot: Q6U820|PLB1_ASPFU
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0004622 = Molecular function: lysophospholipase activity

Sequence:
>Contig4138
TTGGGTGGCTACATGGTTGGGCTTTTGTTTTTGCCGGCATTTATATATTA
CCCATCTCCCCGCTCTCTCCTTCCGATGGTACGTTGCACTTTTTTTCCCT
TTTTCTTTTTTCCCATTTCCCTTTCTGCACATTGTGTTGTGCAGCCAACT
TAATCGTGTGGCTCTCGCACTTGAGACACAGTTCGTTGTTTTCTGTCTGC
CAGCCAGCCTTCGCCGTTTTTGCCTCCCTTATTTCGGCCAGGCACGCTCG
AGATAAGAGAGAATTAATATCCCCCTTCTTCGTGTTCTGCCCCCGAATTA
CCACAAAGTTGGGGGGGGGCACATCGTCTCTTGGCTCAATCTTCTCATCT
TGCACCTTTTTTCCTTGAATAACTTCACTATGCGGTTGCCGACAAGTTCT
CAAGTTTTTCTCACAGCGATTTCGGTCCTGTCAGGCGTACAAGCTGTCCC
AGGCCCGATCCCCCCCCTCACAGAAATCAATGGTCTAGTTACACGCGCTT
TCTCGGATTCTCCCACAGGCGGGTATGCTCCTGGGAGAGCGAGCTGCCCG
TCCGACTCATTGATCCGTAGCGCGAACGACATCTCACCTGGGGAGAAGGA
CTTCCTCAAGAAGCGACAACCTATAACGGATAAAGCTTTAATTGACTTTC
TAAACCGTGCGTCGATGGTGGATTTCGATGTAGGGGCGTTCATGAGCAGC
TATTCGCCCACTATCGGCATCGCATTCTCCGGCGGAGGTTATAGGGCAAT
GCTGTCGGGTGCTGGGGAATTCAAAGCGATGGATAGTCGAACTCCGGGGT
CAACTGCCGTGGGAAACATTGGTGGACTGTTGCAGAGTGCGAAATATATT
GCGGGTTTGTCAGGCGGAAGTTGGCTGTTGGGAAGTGTGGTGATTAACAA
CTTCACCACCATCGCCAAGTTACAGGCGGCGGGGAACGTGTGGGATTTTG
AGAACAGCATCCTAGCTCCGGAAGGGGCATTGCATATTGTGGACACTACT
CTCTACTACAACGACCTTAACCGGGAAGTGCAGGACAAGGACAATGCTGG
GTTTGATGTCAGTTTGACCGACTACTGGTCGCGCGCGCTTTCTCGCCAGT
TTGTCAATTACACTGATGGAGGTCCGGGAATAACTTACTCCTCGATAGCG
AAGACAGATCGGTACAAGAACGCTGAAATGCCGTTCCCCATCATTGTTGC
GGATGGCAGGAATCCTGGGGAGACGATCATCTCTAGCAATGCCACAGTCT
ACGAGTACAACCCCTTGGAGTTTGGATCCTTCGATCCTACTCTATATGCC
TTTACCCCCATGGGATATATAGGATCGAACGTCACCAACGGTGTTCCGAA
TGAGAGTGGTGTATGCGCTCGGGGTTTCGACAATGTTGGATTTGTGATGG
GAACATCTTCATCCTTGTTTAACGTCTTGATTACTGAACTTTCCTCCACC
GGCTTGCCCGGTGTTCTGAGGAAGCTCATCGAGACTACCCTGAACTCAAT
CTCCGCTGCT

Sequences in the Contig:

SY0AAC11YN12FM1 SY0AAC13YC08FM1 SY0AAC25YP17FM1
SY0AAC28YF21FM1 SY0AAC2YF01FM1 SY0AAC39YM04FM1
SY0AAC42YH07FM1 SY0AAC42YH14FM1 SY0AAC43YE11FM1
SY0AAC62YG22FM1 SY0AAC9YN05FM1 SY0AAD27YE18FM1
SY0AAD33YB01FM1 SY0AAD51YL05FM1 SY0AAD55YJ14FM1
SY0AAD5YL13FM1 SY0AAD62YA20FM1 SY0AAD62YG21FM1