Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4137
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00002110001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_506119.1| Score: 236 E_value: 2e-18
KEGG Definition: hypothetical protein
Accession: yli:YALI0F32043g Score: 236 E_value: 1e-18
KOG Definition: No Hit Found
PFAM Definition: RasGEF_N, Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif. A subset of guanine nucleotide exchange factor for Ras-like small GTPases appear to possess this motif/domain N-terminal to the RasGef (Cdc25-like) domain..
Pfam Number: pfam00618 Score: 106 E_value: 7e-06
Swissprot: P39960|BEM2_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005100 = Molecular function: Rho GTPase activator activity
GO:0030036 = Biological process: actin cytoskeleton organization and biogenesis
GO:0007117 = Biological process: budding cell bud growth
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0030010 = Biological process: establishment of cell polarity
GO:0000226 = Biological process: microtubule cytoskeleton organization and biogenesis
GO:0007264 = Biological process: small GTPase mediated signal transduction

Sequence:
>Contig4137
TTGGGCGATGCTTCGTGCGATTAGAGATGTTGCGGGTGTAGGGCAACAGC
TTTTTTATTCTAAGGATGGCGAATTGGTCCTGAAATCAATCACGGATGAT
GCCATTACTTCCAGGCCTTCGAGCGTGATAGAAACGACATCTAAGAGAGT
AAGCGGTGCGTCCAGAAGAATATCTGCCCAATTTTACGGTGATACCGCAT
CTCCCCGTATGCCCGAGCAATTAGATGGTAGCATGCCACCCACGCCTGCT
CGTGAGGAATTTGCTCTGGATAACCGCCGCTGCTTGCCTGTGGTTCCTAA
GGGAGGGACTCTCGAGCGATTGGTAGACATCCTTGTTTTGGGTGTGGAGG
ACTTCAGCAGACGAATGAATGGGTCGGATCCGGTGTTCACTGCTGAGAAT
GCGCCTTTGCTCCGAATGAATATGGATGTATTTACGATTACTTTCTTTGC
TACGTTCCGCAGTTACTGCTCCCCTATTGTCTTAATTGATTATCTTAAGA
AGCGCTTACTGGGTTCCAAATCGGCAGCTACAATTTCAGACAACGAGAGT
GATGATGTTGTATTTCCGGATTGGACGGGGGTAGACCATGTTAGTGACGA
GTCTATCGATTGGAACCTCGTAGCCAAAATTCATATGGGGATTCTTGAGG
CGGTGAACAC

Sequences in the Contig:

SY0AAA46YO20FM1 SY0AAC25YO22FM1