Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4135
Length(NT) : 557
Best Gene Model Blast : Link to GSTUMT00002995001 E-value : 1e-165
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_11780
Accession: ref|XP_001550022.1| Score: 346 E_value: 3e-31
KEGG Definition: hypothetical protein
Accession: fgr:FG01863.1 Score: 325 E_value: 4e-29
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2778 Score: 272 E_value: 4e-25
PFAM Definition: Peptidase_C12, Ubiquitin carboxyl-terminal hydrolase, family 1..
Pfam Number: pfam01088 Score: 221 E_value: 3e-19
Swissprot: Q9UUB6|UBLH2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4135
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAGCACAGCACCCCACCCA
TCAACCAACTCGAGGTTTTGATATTTTTTTTCTTCACCACAACTCACGGT
GTAAACTGAAGCTAACTCGGATCTCCGTCTGTCTCTCACTAGAATATGTC
TGGCGGTTGGAACACTATTGAGTCCGATGCAGTATGGTCTACCTCAGTGG
GAGCTTCTGGGTTTTTTTTGCTGATGACTCTTTTTTTCTTCTTCCTCCCC
TTCTTTTCCTCATAGGGAGTTTTCACCTACCTTGTTGACAACCTTGGTGT
CAAGAATGTCCAGTTCGAGGAGATGATTGCGCTGGATGCGGATTATCTTA
ATCAACAATCTCCCGTTTATGGCGTCATCTTCCTATTCAAGTACCCTGTC
GGCCAGAAGAAAGCCGACGAAGCGGTAGATGGTCAGTACGATTTCGCCGC
TTCTGAGAATATATTTTTCGCGAATCAGACGATTCAGAATGCTTGCGCTA
CTCAAGCTATCCTCTCGGTGCTGCTCAATCGTGGAGATCTTGATCTAGGC
GATCAAT

Sequences in the Contig:

SY0AAC25YO03FM1 SY0AAD46YH22FM1