Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4134
Length(NT) : 1026
Best Gene Model Blast : Link to GSTUMT00012096001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein An01g04430
Accession: ref|XP_001388870.1| Score: 1291 E_value: 1e-140
KEGG Definition: hypothetical protein
Accession: ang:An01g04430 Score: 1291 E_value: 1e-140
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2072 Score: 1111 E_value: 1e-122
PFAM Definition: No Hit Found
Swissprot: O74760|EIF3A_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig4134
TTGGTCCCCACTTCAACTTCACGACTCTCAACCGCAGAGTCAATTCTCTC
AGTGATTTCTTATCACACAATTTCATATCAGCAACTCCTGTCTGAAATTG
CCTTTTACTCGACACGGCGATCGGCTGGCTCTAATTTACGAAAATGCCTC
CACCTCCTCACGCGAAACCTGAGAATGTTCTCAAGCGAGCGCAAGAACTT
GTTGCTGTCAACAAGAATTTGAGTGCTCTTGAACTTCTCCACGAACATGT
TACCGCCAAACGATCGCGACTTTCACCCATCGCTTCACTGGAGCCCGTCA
TGGTGCTCTTTGTGGAGCTCTGTGTCAGCCTCAGGAAAGGAAAGACGGCA
AAGGATGGGCTGTACCAGTACAAGAATATCGCCCAGAATAGCAGTGTCCA
AACGATCGAGATGGTTCTTCGTAAATTCATCGAACTTGCGGAGGCAAAGG
TTACCGAAGCCCAAGAACGGGCGGAACAGATCACTTTAGATGCCATCGAT
GATCTCGAGGCTTCCGAGACACCAGAGTCTATCCTCCTCTCTACGGTTTC
CGGCGAACAATCCCGGGATCGAACGGACCGAGCCGTCGTCACGCCATGGT
TGAAGTTTCTTTGGGAGACATACCGTACTGTCCTCGACATCCTCCGGAAC
AATGCTCGACTTGAAATTATGTATCAGAGCACCGCCTTGCAGGCATTCCA
ATTTTGCTTGAAATATACCCGGAAGACCGAATTCCGAAGACTCTGCGAGC
TTCTTCGGAACCATGTTCAGAATGCTGCGAAATACTCGACTCAGATGCAC
GCCATCAACTTGAATGATCCCGACACCCTCCAGCGTCATCTTGATACCCG
CTTCCAGCAGCTCAACGTTGCAGTCGAGCTGGAGCTATGGCAGGAGGCTT
TCCGCTCCGTGGAGGATATCCATACTCTTCTCAACTTGAGCAAGAGACCT
GCCAAAAACGTCATGATGGCCAACTACTACGAGAAACTGACTAGGATATT
CTTGGTTTCTGATAATTACCTTTTCC

Sequences in the Contig:

SY0AAA4YE20FM1 SY0AAB13YB23FM1 SY0AAB50YI20FM1
SY0AAC25YN21FM1 SY0AAC61YG20FM1