Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4133
Length(NT) : 674
Best Gene Model Blast : Link to GSTUMT00010376001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_07362
Accession: ref|XP_001554225.1| Score: 369 E_value: 9e-34
KEGG Definition: choline dehydrogenase and related flavoproteins
Accession: aor:AO090023000571 Score: 339 E_value: 1e-30
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1238 Score: 115 E_value: 7e-07
PFAM Definition: GMC_oxred_N, GMC oxidoreductase. This family of proteins bind FAD as a cofactor..
Pfam Number: pfam00732 Score: 289 E_value: 5e-27
Swissprot: Q11157|Y492_MYCTU

Sequence:
>Contig4133
TTGGAATCAGGCTATGATAGAAGGATGCAGGAAGTTGGGCTACTCTACGG
TGGCTGTCCCACAGAATACAGGTGCTACTTTACCAGGTGATAAAGAAGGC
ATAGTACGAGAACATGCAGATGGATATTGCGGCAATGGGTGTGGATGCGG
CAAGAAAGGAGATGGCCGGAAAATGGGAACAACCCATACCTGGCTCCCGG
ATGCCGCCCGAGCCGGTGCCCGCTTCATCCAAAGCTACTATACAGATAGA
GTTCTCTTCTCTACCGATGCCAAAACCAAAGCCATGGGAGTAACAGGCAC
TTGGGGCCCACAGAAAGTCCCACTAAAGATCATGGCCAAAAAGGTCATTG
TAAGCGCTGGTTCACTAAATTCTCCATGCTTACTCTTACGCAGTGGATTA
ACAAACCCCAACATCGGCAAACACCTCCACCTCCACCCCGGCGTCACAAT
CCAAGCCTTCTTCCCAGAGCGCACAGACCCTTGGGTAGGCTCCCCGCTTA
CCACCGCCTGCACGCAATTCGAGAACCTAGATGGGAGCTACCACGGCGGC
AAGCTCGAAACCGCCGCGATGGGCCCACTAATGGCCGCGAGTCCGCTCCC
CTGGCTCTCCTCGGCAAGCCTGAAGCGCACCCTGCTGAACTACCGCCACT
CGGGCCTCTTCTTCACAATCCAGC

Sequences in the Contig:

SY0AAC25YN19FM1 SY0AAC28YN10FM1