Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4132
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00007524001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_15727
Accession: ref|XP_001805865.1| Score: 728 E_value: 2e-75
KEGG Definition: eukaryotic translation initiation factor 3 subunit EifCk, putative
Accession: afm:AFUA_3G09280 Score: 644 E_value: 7e-66
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3252 Score: 331 E_value: 8e-32
PFAM Definition: SAC3_GANP, SAC3/GANP/Nin1/mts3/eIF-3 p25 family. This large family includes diverse proteins involved in large complexes. The alignment contains one highly conserved negatively charged residue and one highly conserved positively charged residue that are probably important for the function of these proteins. The family includes the yeast nuclear export factor Sac3, and mammalian GANP/MCM3-associated proteins, which facilitate the nuclear localisation of MCM3, a protein that associates with chromatin in the G1 phase of the cell-cycle. The 26S protease (or 26S proteasome) is responsible for degrading ubiquitin conjugates. It consists of 19S regulatory complexes associated with the ends of 20S proteasomes. The 19S regulatory complex is composed of about 20 different polypeptides and confers ATP-dependence and substrate specificity to the 26S enzyme. The conserved region occurs at the C-terminal of the Nin1-like regulatory subunit. This family includes several eukaryotic translation initiation factor 3 subunit 11 (eIF-3 p25) proteins. Eukaryotic initiation factor 3 (eIF3) is a multisubunit complex that is required for binding of mRNA to 40 S ribosomal subunits, stabilisation of ternary complex binding to 40 S subunits, and dissociation of 40 and 60 S subunits..
Pfam Number: pfam03399 Score: 113 E_value: 1e-06
Swissprot: Q9W2D9|EIF3K_DROME
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig4132
TTGGAAACTCACACCAATTGCCAAGATGACATTCGATACCTCCACCCGAC
CGGAGCATATACAGGGGATCTTGTCTAGTCTCGATCGTTACAACCCGGAA
ACCGTCACGATTTTTCAAGACTACGTACAGCAACAATGTGAGAACAGGAC
CTATGACAGCCTCGCAAATTTGGCTCTTCTGAAACTCTACCAGTTCAACC
CCCACCTCACCCGCGACGAGACAATTACCAACATCCTCGTTAAGGCCCTC
ACTGTCTTCCCATCCGCCGACTTCGGCCTCTGCCTGCATCTCCTTCCCGC
CAACGCCCTGACCGAACCGCCGATCGACCCCTTTGCGGAAGCTGTGCTAA
AGCTATTCTCCCTTTCCCGCCTCTTGGAAGCCTGCGAATATAGGGAATTC
TGGATGACGCTCGAGTCCGATGACTTGTACGCCGACCTGATCACTGACTG
TGCCGGCTTCGAGGAGCTGATCAGGCTCCGCATCGCCAGCACCACAGCCC
AGTCCAATCGTGAGATTAACAGGGAGCTGTTGGAGGGCTGGTTGAATCTC
ACCGCTGATGGGTTCGAGAGCTTTATTAAGGGGAGCTGTGGATGGGCCAT
TGAGGGGGATGTAGTCAAGATTCCGCTGAACAAGGAAAATGAGGCGAAGA
CTACAGTTACTAGGGAGAATGTGAAGTTCGATCAATTTCAAAGGGTTAT

Sequences in the Contig:

SY0AAC25YN18FM1 SY0AAC38YL22FM1