Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4131
Length(NT) : 666
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4131
TTGGGTTTGTACCGGTATGGTGCCAGCACCCTTCAAGTTTTCCCAACCTT
TCGAGTCTCGACGAACTGCAGCAACACAACACGCCGCTACCCCGCCTATT
CCTTCCGCACAATGGTCCCAAATCATGTGGGGAACACATTCGTGGGAGCA
GTAGGGTTGCCTACTATATTAGGACTAGCGCACTGAATCTGGATGGCACA
GATGGTGGACTCTACTCAATTCGGCGACTTGAGTAAGGTGCCGGCATCAT
ACTTGTTGCGATGGTACCGTGTTTACTTAAGAATACCGGTATTGTGATAG
CATATGATAGAATTAACAAGACGGGGCAAGCAAGCAAGACAAGATACCGT
GGGGAACACTAGCCGCCGGAAATGGGGCCGTTACTGGGATAGCTGCGCCG
GTGGGTCACATTGTGCAGGATCGACGGACCGATACCGTAGCAGCTTGCAT
ATTCGGGAATTCAACAGGCAAGTCGGGAAGGCTCTTGTTATGGTAATTAG
GAAGAGAGGAAGGGAAAGAATTCGCTTTCGGCTTCTCTTGTCTTTTTTTT
TTGCTTGTCTCTGTCAGATGCATACTGCTAAATTAATGGCCAACTCCCCT
CCTGTTTCGCTCCGGGGACCGGCTACCGGTGTTAGTCTAAGGACTGCTGG
ACTGGCTGGGGTTCGG

Sequences in the Contig:

SY0AAC25YM14FM1 SY0AAC31YL02FM1 SY0AAD20YM24FM1