Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4130
Length(NT) : 1625
Best Gene Model Blast : Link to GSTUMT00001588001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein CIMG_00398
Accession: ref|XP_001246627.1| Score: 1208 E_value: 1e-130
KEGG Definition: mRNA splicing protein, putative
Accession: afm:AFUA_3G06770 Score: 1191 E_value: 1e-129
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2560 Score: 1082 E_value: 1e-118
PFAM Definition: Caldesmon, Caldesmon..
Pfam Number: pfam02029 Score: 127 E_value: 9e-08
Swissprot: Q4WWR2|SLU7_ASPFU

Sequence:
>Contig4130
TTGGCAAACAGCGAGCCATCGATAAACCTCGGGCTTTCTCTATTTCCCCA
AATCATCCGCTATGTCGTCCTCCAAGCGGAATCCGGAAAAGCAAGCAAAG
AACGAATACATCCCCCACTTTATCGCCAAAAAGCCCTTTTACCTAGACCA
CGACACTGAAGGAGACTATCTCGAGCATCAGCGTCTTCAGAATAAGAAAG
ATCTCGACCTCGCCAACCAAAAATGGTACGACAGGGGCAAACGTGCCGGC
CCGGCCGCCACTAAATTCCGCAAGGGAGCCTGCGAGAACTGCGGAGCAAT
GACGCACAAAGCGAAAGACTGCCTCTCACGGCCACGGAAGAAGGGTGCTA
GGTGGACTGGACAAGACATACAAGCCGATGAGATAATCCAAGAAGTGGAA
CTAGGCTGGGATGGGAAGCGGGACCGTTGGAACGGCTACGATTCGCACGA
GCACAAAAAGGTGGTGGAAGAGCACATGCGCATGGAGGAACTCCGCCGTG
AGAGCGAGCGGAAGAGCGCCGAAGATGTGGAAATGGAAGGCGGGGGAGAC
GAGGACAAGTACGCCGAGGAATCCGAAATGCCCGGGCAAACGTATGACGC
TGCAAGCCGCATATCCACCCGGAACCTGCGGATCAGGGAGGACACGGCAA
AGTATCTACTCAATCTAGACCTTGACTCGGCCAAGTACGACCCGAAAACG
AGAACCATGGTCGACCGCGGCGCAACCCAAGACCAAGCTGCCGCCCTGGT
CGAAGAAGACAACTTCATGCGCTCTTCTGGAGACGCCGCAGAATTCGAGC
GCCTCCAGCGCGCAGCATGGGAATCTCGGGAACGCGGTAACAAGACGAAG
ATGCACCTGCAAGCAAACCCCACCGAAGCAGAACACATCAAGAAGAAAGA
GCAACAAGCCGCGGAGGAAAAACGTGCGAGGGAAAGGAAAGCGCTTCTGG
AACGCTATGGTGGCGAGCAGCACTTGGTGGATAAACCACCCGTGCTTGAA
GAGGAGGAGAGGTATATCGAATACACCGCCTCCGGCCAAGTCAAAGGCCG
GGAGAAGACCACCGCGAAGTCAAAGTACACGGAGGACAAGCTCATCAATA
ATCATACCACCGTTTGGGGATCTTGGTGGCAGAGTTTCAAGTGGGGTTTT
GCATGCTGTCATTCTACCGTCAAGAATAGTTACTGCACGGGTGAAGAGGG
GATTAGAGCAGCTGAAGAGGCGAACAAGTTGCGCTTGGGATTGATTGAGC
CGGTTGCGCCGAGGTGGGTCGAGCAGAAGCAAGAGGAGCAAGAGGAAGTA
GCGGAGGAGGACTCTGTGAAGGATAAGTCTAAAGGAAAGGACGGAGAAGA
TCACGTTGACAGGGGGAAGAGAAAGCTCAAGGAAATGAGAGACGGTGTCA
CGGAGGAGGATATGGAGCAGTATCGGAAACAGCAGAAACTATATAGCGAT
CCTATGGCAAACTTTGTAGACACGGTATAAGTACTCACTTTCCTTCCTTC
TTTTTGGCTCAAGTATTTTCATTTACTTTTTTTTTGTGCGTATGGTGTGT
TTCATTCAATCGGTGTACGGTATTTCCACTTTGTTTATTAATTCACGATT
AAGCCCGCTAGGTTTGAAACAAGGG

Sequences in the Contig:

SY0AAA24YG16FM1 SY0AAA24YG16FM2 SY0AAA24YG16RM1
SY0AAB27YL23FM1 SY0AAB45YL15FM1 SY0AAC25YL24FM1
SY0AAC25YL24RM1 SY0AAC28YN01FM1 SY0AAC28YN01RM1
SY0AAC38YH23FM1 SY0AAC43YH09FM1 SY0AAD60YO19FM1