Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig413
Length(NT) : 864
Best Gene Model Blast : Link to GSTUMT00002836001 E-value : 8e-99
Numbers of ESTs : 37

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig413
TTGGGGTGCGGTGTAAGGTGTGGTGTGATGTGGTTGGCGAGAATACGAGG
GAACAACAGTGTAGGGAAGGAACAGAAGGGGGGCACTGCCTGCTTTGTTA
CGCGAAGGGGTTGGAGGTCTTCAGTTATTCTAAATAATGAATGAAGGGGT
GTGAACCAACGATCGTTAGCATCCCCTTGGAGAGAGTAGAGAGCCCCTGA
TATCTCCTCTACCGGTGTCATCGTGTTCGGTCCTACACTGTATCTTCTTT
TACCAGATAATAAGTATATAAACCTCCACTACCACCTCCCTCTCCAACCT
CTCCTACCTCTGGCATCCGCCTTCACCGCCGTGCTCGCAGATATAACTAG
ACCACGCATCCAACTTTAACTACCAACCCATCACTATATACGTGAGCGAA
ATGAGAATGCAATTCAGACCCGTTCTCCTAATGGCCCTCCTGACGGCCAT
CACCAGCGCCACCGCTGTCCCTGCCACAAAATTGCCCTGCGACAGCGACA
TGCACCCTTGCAATCTTTATGCAAACGAAGTAGACTGCTCACCAGAGTAT
GTCAGACTTTTGCAATTGTGCGTGGATAGCGGATGTATTCAGTGGATTAT
AGATCCTTTGCAGCATTGTCGGGGGGATACTTATTAAGATACTGTTTGAG
TTCGTATAGCCGTGGGAGATATTGTGTGCGGTGGTGGGGAAAGGGGGTTG
GGAGGATATAAAAGTGTTTGAAGGGGGGCTGAGGGTATGGGTTGGAAACT
GGTCAAGGGATAACATCTCGATCTTCTCGTATACTGTACTTTCGTTCTTG
TGAGGTTGATTGTTGTCTTGTTAATTAAGTACCCGTGGAATACTACAAGA
ACCCTTGATAATTT

Sequences in the Contig:

SY0AAA12YG16FM1 SY0AAA23YG14FM1 SY0AAA29YD07FM1
SY0AAA29YH04FM1 SY0AAA35YF08FM1 SY0AAA37YH04FM1
SY0AAA40YN18FM1 SY0AAA42YN08FM1 SY0AAA46YN03FM1
SY0AAA5YC12FM1 SY0AAA61YE08FM1 SY0AAB10YJ24FM1
SY0AAB18YA03FM1 SY0AAB24YA09FM1 SY0AAB24YD08FM1
SY0AAB24YN14FM1 SY0AAB28YB17FM1 SY0AAB28YG04FM1
SY0AAB33YH10FM1 SY0AAB36YN03FM1 SY0AAB38YB22FM1
SY0AAB38YM08FM1 SY0AAB39YC22FM1 SY0AAB39YD10FM1
SY0AAB41YC12FM1 SY0AAB41YC13FM1 SY0AAB41YN09FM1
SY0AAB42YJ17FM1 SY0AAB42YM21FM1 SY0AAB43YL05FM1
SY0AAB44YA24FM1 SY0AAB4YN02FM1 SY0AAB51YI18FM1
SY0AAB52YE15FM1 SY0AAB59YE15FM1 SY0AAB61YB07FM1
SY0AAB61YI08FM1