Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4129
Length(NT) : 700
Best Gene Model Blast : Link to GSTUMT00004791001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: peptide methionine sulfoxide reductase
Accession: ref|XP_001272870.1| Score: 693 E_value: 3e-71
KEGG Definition: peptide methionine sulfoxide reductase [EC:1.8.4.11]; K07304 peptide-methionine (S)-S-oxide reductase
Accession: aor:AO090120000273 Score: 666 E_value: 2e-68
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1635 Score: 547 E_value: 6e-57
PFAM Definition: PMSR, Peptide methionine sulfoxide reductase. This enzyme repairs damaged proteins. Methionine sulfoxide in proteins is reduced to methionine..
Pfam Number: pfam01625 Score: 550 E_value: 3e-57
Swissprot: Q09859|MSRA_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4129
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGACAACGTTAATGTTCACA
TCTCTCCTCCCTCGCTTCTTCCGCCTCTTCTCAGCCAGCAAATTCACCTT
GGGTCCTCTCGGCGGCAACATGTCCCTCCCGGAGACCACCGAAAAAGCAA
CATTCGCCGCTGGGTGCTTCTGGGGTGTCGAACATCTCTTCCGCAAACAC
TTTACAGGCAAAGGCCTGTTGGATGCTCGAGTCGGCTACATAGGTGGGGA
CACCGCACACCCAACCTACCGTTCCGTTTGTTCCGGGACAACCGGCCATG
CCGAGGCGCTCCAAGTTCTCTATAACCCTTCAGAAGTCACCTACGAGAAA
CTTCTAGAATTCTTCTTCCAGATGCACGACCCAACAACGGTGGATCGCCA
GGGGCCAGACGTGGGATCCCAGTATCGCTCGGCGATATTCTTTCACAATG
ACAAGCAGGAGGAAGCTGCCAAAGCGGTGCTGGAGAAAGTTACGAAGCAG
TGGTATAAGACCGACATGGCGACTCAGGTGATCCCCGCTGGGGAGTGGTG
GGATGCAGAGGATTATCATCAACTTTATTTGGATAATAGAGGCTATGAGT
GTCCTTCGCACTATCTGCGGACCTTTCCACCGCTCGCTTGATTGGTTAGG
CGCAAGTGTCGAATTGGTGGATAGCTGGGTTACGTGAGGTTTAGTGCCAG

Sequences in the Contig:

SY0AAC25YL15FM1 SY0AAC35YK13FM1 SY0AAC40YA08FM1
SY0AAC47YF23FM1 SY0AAC60YN09FM1 SY0AAC9YH24FM1
SY0AAD29YL19FM1 SY0AAD36YF16FM1 SY0AAD60YF10FM1
SY0AAD9YC20FM1