Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4128
Length(NT) : 1942
Best Gene Model Blast : Link to GSTUMT00000549001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein FG07930.1
Accession: ref|XP_388106.1| Score: 312 E_value: 2e-26
KEGG Definition: hypothetical protein
Accession: fgr:FG07930.1 Score: 312 E_value: 9e-27
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 148 E_value: 5e-10
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 143 E_value: 2e-09

Sequence:
>Contig4128
TTGGCTCGTAGTTGGGAAGATTGGGTCCGCTAAATAGGGTCTGCTAATAG
GGTAGGGTCGGGAAAAGTTTATTGTTGTCTAGGCTTGGCAGGGACTGCCA
AGGTATCATAGTGAGGGGGGTGTGTTTGTTGAGCCTCATTGCTTCTTTTG
ACGTTCGCCTCGGGTCAACATTGCATTTTATCATATAAATGACGGAATTT
CAGGGCGATTGACCAAGGAGTTTGCCACGCAACTGAATTTACGAGATCTA
CAAGACTCGCTTCGCCTCCGGAGTGTGCCTGACACTTTGGGGAATCGACA
CTGGTTAACGACGACGACAACAACGACAGCAACACGGTGGTCGACGTAGG
AGACGGTCTATTGGTGACATATTTGAGGGCTCTGTGACTACGAGAGGGGT
GGACAGGATCAAGGGGTTCTTCTCTCAAGTGCCCCAGAGTTTTCCCACTA
ACAAGTTGGTGGTCGTGGGGGATACGGTATGGTGTCATGGCTTCCGCTAT
CCTGGACCATCGCCCTATATCTAAGCAAACAGCAGACTAGTCTCTAATAC
ATATAGATTCTTCAGCTAAAATGACCTCAACAGAACAATACATCGACTAC
CCAACCCTTCTCTCCCCGACCTTCTCCCCAACAACCTTCTCCAGCTCACT
TATCTCGCAGACCAACCACCCCAATGAGCCACTTGACCTCACAACCCCCC
TCTCGCGCGTCCTCTTTGACCTCCAGGAAATCGACACAACCCTGCACACC
TTAACCACCACCTCTTCTACCTTACTGTTAACGCACACTGCCACGACGAC
CCACGCTTCGTCGACCCTGCTCTCGGCCGTGACGGCGCAAACGGCCACAC
TGAACACGGCGTACGAGCGGCTACGCCGCGAAGTTATTGACCGCGGTGAC
CGTGCAGAGGAGGTGGTCTGTGCCGTGCAGAACCTGCACGCGACGACGAG
GGTGCTGCGGGAGGTTAGCCGTGGCGTGGTGCTTGCTCGGCAAGTGGAGC
GGCAAGTGGCGGATTTGGAGCGCGGGGAGTGGAGCGCTATGGTTCGGTGC
TCTTTTAGCCTGCTAGAGTTGGGGAGGTTGTTGGAGCAGGGGGATGGATT
GATGGAAGTGGACCTGGCGAGGTCGCTGAACGAGAGGGTTTACCAGCCTA
CGCGGTCGAACATCATTTCCCGGGCGAAGGAGATAATCACCACATTTTCA
CTCCTCACCCCGGACACATCAACCCCCTCCTCCACCACCACTCCTACCCC
TCCATCCAGTGCCGCCTTCACAGCCCTCCCCTCCACCTCCCCAGCCCTCC
GCCAAAAGCTTTCCAGTACTCTCCAATCCCTCTCCCTCCTCTCGCCCCCT
GATCTTCACACATCAATCCGCACCCTCCTGCAGACCCACACAACCGCCAG
CACTAACCTCCTCACGCGTGCCCTAAACTCACTTACCACCCTCGACCGCA
CCCTCGCCGAAGTCTCCATGCGCAGCCTCTCCGTCGCCGCCGTTGAGGGC
TACCTCGACGGCGTTGGCCTCGCGCAAACCGTCCTAGCCGAACTCGATAT
GCGCCGTCTAACGACAGGGTTTTGGTGCGGCGTGGCGGCTGGCTGGGAGC
CGAGGGTCAGAGATGTTGTGCTTAGGGGGGGCGCCAGTGCGAGGATGTTG
AGGGCTGGCAAGGAGAGGGTGCGGGAGGGGGTTAGGACTTGCGTTCATAG
GGGTATGGGTATAGAAAGGAGGGAAAGTGGTGAAGGTGAGGGGGGTTTTG
AGGTTGCCATTATGGTTGGAGCGTTGGGGAGTTTAGGGAGATGACTTTGT
ATCATACCTAGGAAGGGTAGGATCATGTTAAATCACTCGTGTATTGGTGT
TGGAAACAAGCGGTTGGTTATTGTGTATTTATCTCTAGTTATCATACCAT
ACCTAGTACAGGTATCCTACAGTCTCCAAATCCCTACACGAT

Sequences in the Contig:

SY0AAA22YM23FM1 SY0AAA22YM23RM1 SY0AAC25YL10FM1
SY0AAC25YL10RM1 SY0AAC33YL06FM1 SY0AAC59YK11FM1
SY0AAD29YI07FM1 SY0AAD32YE17FM1 SY0AAD40YP09FM1
SY0AAD4YB16FM1