Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4127
Length(NT) : 1160
Best Gene Model Blast : Link to GSTUMT00009118001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein AN2779.2
Accession: ref|XP_660383.1| Score: 931 E_value: 2e-98
KEGG Definition: hypothetical protein
Accession: ani:AN2779.2 Score: 931 E_value: 8e-99
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4127
TTGGACCGCACACACGCACTTCACTCCGCATAATGCGCTCTGTATGTGTT
TTTATGCTTTTGTATTCCCGAATACTTTGCCCCGCTCCTTGTATGGTAAT
TTTTTTCCCTTTGAATGGTGGGGAGAGGGGAGATGGGGTTAGGTAAGGCG
ATGAAAGGGGAAATTGCTAGGGCCTTGTGAGGCTGCGTGATAGAATGAGG
CATTCGGTATCAGGTAGTCTATAATATTATGGAGTGGATAGGAGTTACCT
CCCCCCGGAGATTATTTTGTTGATCACAAGTTATCTTGGTGCACAGAACG
CCTTCTTCCTTTCCGTCCTACTTCCTTCTCCTCTCCACCACACATCTTGT
CTAATACGTCAAAGTTGAGTGAAAGTTAAAGAGGACTACTATTCAATCAT
CTTACCTGCCATGACCGAGAACGCAAGTGCAAGCGCAACCGCCAATGCCA
CCACCGTCAACGGGATGTCGGGGAATCCTCTGCAACCGAAGAACTACGAA
ATTGCCGGAACTCATCCAGATAGCAGAATTCTGTTTCGTGATGTTCGTAT
TCTGGATTCCACTGGGAGAGAGCCTTATCCTGGTGATGTTCTGATTAAAG
GAGAACGTATCGTAGAGGTCGGTACAGTTTCCAACATCGAATCACTCATT
CGCGACCCGACAGTTCGGGTATTCAGCGGTCGCGGGAGAACTCTGATGTC
GGGATTATGTGACGCTCACACCCACCTCACCTGGAACGGGGGAGACCTCC
GCGCTCTTGGTGAGCTTGGCGTCGAAGAGCACACCCTCCTTACCATGCGC
TCTGCTCAATGTTTCCTTGACTCGGGATACACCATGTGCTGGGGCGCTGC
CTCTGCGAAGCCGAGATTGGACGTTGTCATCAGAGACGCTATCAATGCTG
GCCATATCCCTGGGCCAAGGTGTTTGGCTAATGGACAGGAACTCGCCAAG
GTGGATGGTGAATTGGTTCCTGGAATTACTGCGTATGCGAATACTCCGGA
GGAAATTAGGGAAGTTATTCGTGAGCATGTTAAACTGGGTGTGGATCAGA
TCAAGCTGAGTATCTCTGGTGAGTCGGTTACGGAAATCAGAGCCGCAACA
GACTGTTATTTCTCTGCAGAAGACATGGAAGCTGCCGTTGATGAAGCACA
CAAGCATGGA

Sequences in the Contig:

SY0AAA20YP06FM1 SY0AAA33YA19FM1 SY0AAA33YJ06FM1
SY0AAA3YA23FM1 SY0AAA4YK03FM1 SY0AAB9YB03FM1
SY0AAB9YG10FM1 SY0AAC25YK05FM1 SY0AAD27YB14FM1