Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4126
Length(NT) : 462
Best Gene Model Blast : Link to GSTUMT00009188001 E-value : 2e-92
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4126
CCTTAGAAGCCTATATATATTCCGCGATTCAATGAACGGGAAACAGAATT
CCCTAGTAGTCTGACCTTTCACAACCTGTCGCCCGGGAGGTGATCCGCCC
AAGGCCACCTACCACACCCGATGGTCTGATGAGGCGCAATTAGGGGGAAA
AGTTCTCAAAATTCACTACTTAAACCTAGACACTAAAAGTACTGCATATC
AAAGCCCCTTTCGAAATCCCATACATCATCCTCAGCCCTCATATGCCCTT
GCTCTGCCATATGAAGAGCAAAGTCGTCCCTCAGCCACCTCCTCTCGCCC
TCCTGTCTTGACCCCTCCCTCTCATCTCCCTGGACCCTAATATCACCTGC
GTCTATCCCTACAATCAATAACACTCGTTCCAGAAGTTTACTCAATTGCT
TGTGCGTTCTCATACTCGCCATGTCGTTTCCCGATATCCCATGCAGCCAC
TTGACAACTTGA

Sequences in the Contig:

SY0AAC17YF22RM1 SY0AAC25YK04RM1 SY0AAC27YB24RM1