Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4125
Length(NT) : 3128
Best Gene Model Blast : Link to GSTUMT00004515001 E-value : 0.0
Numbers of ESTs : 69

Blast Results:

Nr Definition: hypothetical protein SS1G_11425
Accession: ref|XP_001587433.1| Score: 1298 E_value: 1e-140
KEGG Definition: nuclear transport receptor RANBP7/RANBP8 (importin beta superfamily)
Accession: aor:AO090011000635 Score: 1288 E_value: 1e-139
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1991 Score: 926 E_value: 1e-100
PFAM Definition: HMG_box, HMG (high mobility group) box..
Pfam Number: pfam00505 Score: 181 E_value: 1e-13
Swissprot: O59809|IMA3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005635 = Cellular component: nuclear envelope
GO:0005525 = Molecular function: GTP binding

Sequence:
>Contig4125
CAAGACATTTAACTTTCTAATTCTGGGGCATGGGAAGAAAAGGAAAAAAC
GAAAGCAATGGAAAAGGGAGTATAGGGGAAAGGGGAAAAGGGAAAGGGGG
AATAAACAGAAAAAACCCTTGACGGAAAAGCAAGTGGTGAGAGTTGAAAA
AAAAGACCCCTTGAAGGTTGTAAGAAAAATAAATAGGACAGTACCCGAAC
CCGAACCCGGCTTTTTTTTTACCGACACCACGGACAAATGAACAAAGGCA
TTAAATTTAAGATCCATTGCATAAAAACGTCAAGACCCTGGCAAAATCCT
AATTGCTGCCATTTTTTACCCCCAGAGCTGCTGCAGTCGCCTCACTAGCG
CGGGATTTAGCTTCCGCTTCCATGATCACGCCCTTAATGACGTTCCTATC
ATCTTCGCTAAGAGCTTTAGTAAGGCCTTCGTAGATATGAGGTTGCGTAT
TTTGAAGATCCATCAAGGCGCTACGGAAAAGCATATAAGGCTCGACATGG
TCAAGAGGAGTCTCCAACAATGTCTCCTCCTCAAGGTCTTCCTCCTCATC
AGCCCATGCAGTAGCTAGGCCCGAACTTCCTCCACGAGCCTGGGCCTCGC
TGTTCAGGAAGTCCATATATGCACTGCTCTCATCGGGAATATCCGCCTCG
TCGCCTTCATCTGCATCGGCACTCCAGGTAGCCTCACCTTCCCATTCCGT
ATCGCTCTCTGTGTCATATGTATCATCTATGGTCAACCCCTCCTTCTGAA
TTTCCTCACGATTCTTCATTGCGACGGGTAGAGTCTGGAATAATTGAACA
ATCCCTTGCATAAGCTTGGGCCACCCGGGCTGAATACTTTGAGGAACATG
CTCAGCAGGTAGTTGTATTAATGCAACGATTGCCACAATGGACAACTTCT
TGTCGTGAACCCGATTAAAGTTCTCAATGTTTGAGAACCACAAACTAAAG
AATTTGTTCGTCCAGCCGTGCTGCTCAAGAATTTGTAACGTAACCGAGGG
GTTATAGTATATGCAATTGATGACCATTTCCATCAAGTGAATCCTATATG
ATTTGATGTCTCCCGGGGCGTTGAGACATGTCATTGCGATCTCAACAAAT
CGAGGAAGATACTGATCGGCATGGCCTCGGAGGTTGAGAAGTACAGCCTC
AGCGAGCTTGCATCCGCAAATGCGATCCATGGCTCCTAGGCGCTCATTTG
TGAAGATAGTTCGAATGATGTCAAACACAGCGTCTAACAAGGCAGGATTT
TCCTTCAGCGTACCCGCGCCGTACGAGACATAATTGTCGAGGGCGGGGAG
CATTTCCTCAATATAAATTTCTCCCCGGTCTTTGAATGATTTATGAATGA
GTTCAAAAACCGCCCACATAGTATTCGAGATTGCCTTAGCAGCGAAGGTA
CAGCTGTCAATGATTTCGAACACCTCATTATATAAATCAAATAATTTATG
TTCCAAGGTGATGGTAATAACGGGGACGAGTATTTGCTCAAGGAGTAGGA
GAACACTAGGGTTACTTTCCAGTGTTAAAATAAGGGTCCCAATTGTCTGC
AAAACGCCCAAGGCTGTAATGCTCTTGTCATCTAGATAGTTGTCGGCATC
ATCATCAAGTGAATTTGCACCCTTATCAATAACATCCTGGACTATACGGA
GATAGGTATCTCTCAGTTGCTCGGTGAGTTGTACAGCAAACGGTGTCAAC
TCCGACGCAAATACCTCAACAAATTCTTCCCCAACTTTTTTGTACAAAGT
TGTCCCCCCAACTTTTTTGTACAAAGTTGGCGACAACCGTCAAGTTCCAC
CGACAACCGTCAAGTTCGACAGAAACATTCGGCCTTTCTACTTGCACCTC
TCCACTCACGTCGTTTCTTTTTTTCTGCCACTATGACTGCTTTGTCCATG
CTCAATATGGCCGTTGAAGCCGGGCCTCTTATTCACCAACGTTATGATGG
GATCGGTCTCGCCGAGTATATTCCCTTGCTCGCCAATGGAACTTTTTTCT
TTGATGGGTCGGATGGAGCCCCGCTCCAGGTCCGTCATCTCCTTCCAGCA
GACTGGAAGCCCGTCAATGGACCACTTACGGTCTTGTTCGATTCCGCCCC
CCATACCATTATTGGGACTCACTTCTCTATCCACAATCATCCCATTTACA
AGCTTAACGATGGTTCTATCTTTGTTGTCTTGGACCTGGCCACCAAGCAC
GGTTTTGAGTTTACCAATCAATCTTTCATGGACCCCCAGCTTGAGGTCTC
CGGGGAAAACCGTTTCTTGCGTCTCGTTACCAATGACCAAGACTTCGCCT
ACCATGGCTCTAGTCTTAGCATGATTCATGACAAGGGCGTTAAGCGCCCT
GCCAATGCGTTTATCTTGTTCAGAACGGACAAAATGAAGCCCCTCAAGGC
TCAGTACCCGGAGATGGGCAACAACGATATCTCCAAGATTCTCGGTCGCA
TGTGGCAGAATTCCTCGGATGAGGTCAAAAATGTTTATAAGGCAAGGGCC
CATCAGCTTGCGGTTTCCCACAAGTTGATCAACCCGGATTACAAATACTC
CCCGCGCCGCTCTCGCGAAATCATGAGGAGGGGCTCCGGGAATAAAGGTC
CTTCGGCCCGTATCGACCTTCATCGTGCTGGTGTTGCGAAGCGTGGAAAA
AAGAGGATCATTACCCACCTTGGGTTCCTCACTCAACGTTTCGCGACTCA
CCCCACTGCTAACAATCTCGGTGATATCATCGAGGAAGCCGAAAAGGTCT
TGAAGGCCTTTGGTATGGTCAATTGAGTGATCTCTACGGAGGGACTCATC
GGTACCTGGGTGGTATACTTTTAATGGGAGGGATGATCTTGTCTATCAAA
GGTCATTCATTATCTCAGTCGACTAAATTTATGACCTAAATAGATAAAAA
ATATCTTTTAAAACCAAAATGAGGGGTCCGAACACTACATCATACAGTAA
ATATCAAGTTGTGAAGCGGAAGAGAGCCGACTATGGGAAGAGGCAGTAAG
AATTTAATTCTGACTAAGTCTGGAAAGTTTACACAGCACTTGCACAGAAG
TTATGCTATGGTGGTGCCATCACCGGAAAAACACGCCAAAAATTCGGGAC
CTATGGTGCCGTGACTTAGTTTGAGCGC

Sequences in the Contig:

SY0AAA15YH04FM1 SY0AAA31YB24FM1 SY0AAA31YC01FM1
SY0AAA38YF14FM1 SY0AAA38YH23FM1 SY0AAA38YP20FM1
SY0AAA44YO18FM1 SY0AAA46YI10FM1 SY0AAA46YJ24FM1
SY0AAA49YO22FM1 SY0AAA50YC16FM1 SY0AAA52YN21FM1
SY0AAA55YI17FM1 SY0AAA61YB15FM1 SY0AAA63YF20FM1
SY0AAB21YL15FM1 SY0AAB35YE01FM1 SY0AAB39YI12FM1
SY0AAB42YI19FM1 SY0AAB48YO22FM1 SY0AAB4YG07FM1
SY0AAB5YM16FM1 SY0AAC13YB01FM1 SY0AAC13YC20FM1
SY0AAC19YL06FM1 SY0AAC19YL06RM1 SY0AAC22YF09FM1
SY0AAC25YJ15RM1 SY0AAC26YA08RM1 SY0AAC28YJ10FM1
SY0AAC30YO22FM1 SY0AAC31YN04FM1 SY0AAC33YA11FM1
SY0AAC3YC14FM1 SY0AAC40YH15FM1 SY0AAC43YD11FM1
SY0AAC44YI11FM1 SY0AAC48YJ07FM1 SY0AAC49YP06FM1
SY0AAC4YM16FM1 SY0AAC52YA22FM1 SY0AAC54YF04FM1
SY0AAC55YB15FM2 SY0AAC58YA03FM1 SY0AAC58YC03FM1
SY0AAC5YA14FM1 SY0AAC5YF20FM1 SY0AAC60YL09FM1
SY0AAC62YA01FM1 SY0AAD10YN06FM1 SY0AAD21YO22FM1
SY0AAD28YG20FM1 SY0AAD30YD17FM1 SY0AAD30YL07FM1
SY0AAD32YO23FM1 SY0AAD36YI22FM1 SY0AAD39YJ17FM1
SY0AAD40YM15FM1 SY0AAD41YP08FM1 SY0AAD43YO02FM1
SY0AAD44YP04FM1 SY0AAD46YC12FM1 SY0AAD47YH06FM1
SY0AAD55YB08FM1 SY0AAD5YF21FM1 SY0AAD60YE16FM1
SY0AAD60YJ05FM1 SY0AAD61YO23FM1 SY0AAD63YD01FM1