Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4124
Length(NT) : 2552
Best Gene Model Blast : Link to GSTUMT00010345001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_03136
Accession: ref|XP_001595048.1| Score: 722 E_value: 1e-111
KEGG Definition: hypothetical protein
Accession: ncr:NCU09157.1 Score: 639 E_value: 4e-96
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4124
TTGGCTTCCCCCCCCACATTCAATTCATCATGGCGCACCCAAAGGAATAC
TCGTTGTCAGGATTGTGGGGGAAGTTGGGATTGGATGTTCCGACGTTGGT
GTTGATGGCAAAAGGAGCGCTCCCGTCAGTAATATTCACCGCGGCGTATC
AAGCGACTCCCGTGGCAAAAACATATTCAACCCTTGGCTATGTTGTTTCA
ATCATTGCCGCGTTATCGCTATGCATTCTCCCCCAAGCAAAGCTGGTTCA
ATTGACGGTTCAAAACTCCATAGCAGTGGCTCTCGCAGCCGCAACATCCT
TGCTAGGAGTCTGGACAGCAACTCGTGCGCGAGCTCATTACCCTTCTCCG
CCCAGGCAAAGATATAATGCCTCCGCTTCCGCGGTTTCGGCCGCTTGGCT
GTTTGTCGTCATCTGGCTGGCCAACCTTTTAAAAGCGAGGATACCTTCAC
TCGCGCTCCCAGTTATCATGTACACTATATTTGTGTCCATCATTTACACC
AATGGTGGACTCTACACGATGCCTCAGGCAATTAATGCGGTGGTCTTAAT
GCTCAAGTGTTTCTTTACCGGATACGGACTTGCATTCGCTGTGGGGATGA
TTGTTTTCCCGGTGAATCTCGACAGATTTGGTGGAAGGTATTTGCGGGGT
ACCTGTTGACCTCTAAACAGTTATTGGTGGAGCAGAAAAACTTCTTGAGA
CAACATGAGACGATGGGAACGGAAGAGGGTAAAAAGTCTGCCGCTGCGCT
TGCAGCTCTCGAGAAAGCACATGCTGATCTTTTCACCAAATTATCGACCG
AATTGCCAATGGCGAAGCGGGAGATCGCGTTGGGCCGGTATTTGACGAGC
GATCTTCAGGAAGCGTATCGCCTAGTTCGAGCAACTCTACTCCCGTTACA
AGGGATGACTGTGATTTTAGATATCTTCAATCGTGCACCTAGGATGGATT
CTGAAGAGGATGAAAAGTGCCCTATACCAAGGGAAGAGCAACTACCTGAG
GTCATGAAAACCTTGCACGAGCCTTATGAACGGATAGTAGGAATGTGTGG
TGAAGCAATCGAGCATGTCCTTCTGACAATGAAACTTAAGTCCCCTCCTA
AAAAGCCTGGGGGAGATGAAGAAGCACCGAGTATGGAACCCGGAGAGGAA
GGTTTCTGCCAAACGCTTGAAGAGAAAGTGCAAGAATTTTATAACACACG
TGCGGGGGATGTGAGAACATATTTCACTCCAAGTAAAGCAGCCAAGACCC
AGGACACTGCAGAAGGCATCTCGGCCGAAGTGTATATGGATGAGAAACGC
CGCAGCGAGTTATACCTTGTTCTTTTCATGGAATACCTACTCTACAACGC
GGCCAAATCACTCTTAGGACTCGCTCGATTCGCTGAGGAGAAGAAGCAAC
AAGGTGTGATAGACAGTACAAGATTAGTGTATCCTACCGCCAAACGCTTG
AAAAAATGGCTGCGCTCTATGGCATCTGATTGTAATGACGACATCGTTGA
TGTTTCCGATGTTTGTGCAGTAAGGGTTCCAGGGCTTGGCGGGATAGCAC
CAAAGAAGGACCCTGAGCACTTGCCTGCTAGAAATTCCTTGCAGAAACTC
GGGAATCTGATTGCCGTTTTCACGGAAGGTATTAGTAGCAGCGAGAGTGG
GTTTGGGCTTAGAGTTGCCTGTGCTACCCTTGCTGTTGCTTTACCCGCTT
ATTTTGAGTCAAGTTATATTTTCTTTACTGAACAGAGGCTGGTGTGGGGG
TTGATAGTAATAGCTATTGGAATGTCTCCTACCTCTGGGGCTTCGTTGAT
AGGATTTGTCGGAAGAGTTGCGGGAACAGTAATAGCTACAGTACTTGCAC
TGATAAATTGGTATATTGTGGATGGGATAACACCGGGAGTAATATCGTTT
CTGTGGTTCTTCGTCGCTATCGAGTTTTACTTTGTTATCAAGCACCCGAC
CTTGATCCAAAGCACACTGACAGCACTCGTTACACACATTATCATCGTCT
GTATGAACTCTAGAAACGTCCTCTGGATTCTCTTTTCCACATGAAATCAA
CTAAAAACCCCTATATAATAGGTTACGAACTCCAGGTTCGCAAAATTGGC
AATGAAGTCTCAGCACGAGGTGGTCAGCCCGTCCTCTCCATCAATGAAAT
CGGACCCCACCGCCTACTCGTAACAATAGGCGGCCTCTGCGTAGCAATGA
TATTCACAATCTTCCCTTACCCAACCACAACCCGCAGCCTAATCCGAACT
TCCGTGTCGTCGTCCCTCTTCCTACTAGCAAGAACATACAGCATTACACT
CTCACTTCTCCAATTGAGAATCCACGGTACGGCCGGCGACGAGTCAGACA
AAAACTCACCAGGACGAAGGTACGAGAAGGCGCGTGTGAAGCTCCTCACA
GAGTCCTTCTTGGCAAACGACTCTCTTCGCTCCCAGATAGAATTCACAGG
GTACGAACCCTCACTCCGAGGCCGCTTTCCAAGAGAACAGTACGACGGGG
TCCTAGAAGGTGTGCGGAATATAACCAGCTACCTATCCATAATATCCTAT
GC

Sequences in the Contig:

SY0AAA32YK04FM1 SY0AAB33YJ16FM1 SY0AAC21YD18FM1
SY0AAC25YJ14FM1 SY0AAC56YM17FM1 SY0AAC61YF09FM1
SY0AAD36YE02FM1 SY0AAD59YP11FM1