Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4123
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00006383001 E-value : 1e-111
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein CIMG_05624
Accession: ref|XP_001246183.1| Score: 246 E_value: 2e-19
KEGG Definition: predicted protein
Accession: aor:AO090701000784 Score: 235 E_value: 2e-18
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3337 Score: 160 E_value: 5e-12
PFAM Definition: PRELI, PRELI-like family. This family includes a conserved region found in the PRELI protein and yeast YLR168C gene MSF1 product. The function of this protein is unknown, though it is thought to be involved in intra-mitochondrial protein sorting. This region is also found in a number of other eukaryotic proteins..
Pfam Number: pfam04707 Score: 141 E_value: 8e-10
Swissprot: Q05776|UPS1_YEAST
Gene Ontology:
GO:0031314 = Cellular component: extrinsic to mitochondrial inner membrane
GO:0005758 = Cellular component: mitochondrial intermembrane space
GO:0006627 = Biological process: mitochondrial protein processing during import

Sequence:
>Contig4123
TTGGCATAGCCCCCCACTTTGTCGTCCTCATCGTCATCCTCAGCGGTTCT
CCTTCCACCCCACCGCTCGTCGGCTAGTCGCTGTCAACTTGAGAACTTCT
TTCAAGTTACGATCCAATCGTCATTGTGGCACCGCTCTCCTCATTCATTC
TTCCTACTTGCCTGTCTCACTTTGTCCCGTCGGTACGGGACTGCTATCAA
CCGACTAGTCGTCCGTCTGTTTGATTCAGTTAGCTTGTGTCTTGCGCTCA
CGCACGCATACTTAAGTCGATCGCATCCGCTTTCTTATCTAGTTGTCTAC
CCCGTCCATCCTCCTCCATTCATCTGTTCTGCTTTTCTAAGAGCATTGAC
GTACCTAAAGATACGGTACGGTACGGTGCTTCCCCCAATTTCTCTCTAGG
TAGAGGGTTGGAAGGGGGTATTTTTTTTTCTGAGAAAGATTGGAAGAGGG
AAGGATTGGTGGTGAGGAAAGAACGATGGTGAAGTTTTATGAGAATTCGT
TTTCTTATGACTACCAATGGCCAGCCGTCACGCTTGCTTACTTCTTGCGG
TATCCTAATCCCTACTCAAAGCATGTGGTCTCAAGCGATACGCTATCATC
TCAGTTGGACCCTCAAACCGGCAATCTTCACGTAACTCGTCTACACCTGA
AACGCGGAAAACTCCCCGCATCGCTAG

Sequences in the Contig:

SY0AAA18YM01FM1 SY0AAA3YL02FM1 SY0AAC21YM21FM1
SY0AAC25YJ12FM1 SY0AAC27YH23FM1 SY0AAC36YJ19FM1
SY0AAC38YI08FM1 SY0AAD12YP02FM1 SY0AAD57YK10FM1